Incidental Mutation 'R2181:Colec12'
ID237210
Institutional Source Beutler Lab
Gene Symbol Colec12
Ensembl Gene ENSMUSG00000036103
Gene Namecollectin sub-family member 12
SynonymsCL-P1, SRCL, Scara4
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9707648-9877995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9846828 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 75 (S75T)
Ref Sequence ENSEMBL: ENSMUSP00000043220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069]
PDB Structure
Mouse Scavenger Receptor C-type Lectin carbohydrate-recognition domain. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040069
AA Change: S75T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103
AA Change: S75T

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Colec12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Colec12 APN 18 9848826 missense probably damaging 1.00
IGL02477:Colec12 APN 18 9859858 missense unknown
R0128:Colec12 UTSW 18 9858921 missense unknown
R0130:Colec12 UTSW 18 9858921 missense unknown
R0178:Colec12 UTSW 18 9858921 missense unknown
R0179:Colec12 UTSW 18 9858921 missense unknown
R0180:Colec12 UTSW 18 9848890 missense probably damaging 0.99
R0180:Colec12 UTSW 18 9858921 missense unknown
R0318:Colec12 UTSW 18 9848446 missense possibly damaging 0.77
R0344:Colec12 UTSW 18 9858921 missense unknown
R0573:Colec12 UTSW 18 9858650 missense probably damaging 0.97
R1028:Colec12 UTSW 18 9866837 missense unknown
R1693:Colec12 UTSW 18 9866765 missense unknown
R1951:Colec12 UTSW 18 9859975 critical splice donor site probably null
R2008:Colec12 UTSW 18 9874813 missense probably benign 0.03
R4258:Colec12 UTSW 18 9720950 missense probably damaging 1.00
R4794:Colec12 UTSW 18 9848984 missense probably damaging 0.99
R5269:Colec12 UTSW 18 9846825 missense possibly damaging 0.67
R5369:Colec12 UTSW 18 9866750 missense unknown
R5421:Colec12 UTSW 18 9858580 missense probably damaging 1.00
R5608:Colec12 UTSW 18 9848267 missense possibly damaging 0.95
R5668:Colec12 UTSW 18 9848963 missense probably damaging 1.00
R5684:Colec12 UTSW 18 9849009 missense probably damaging 0.99
R6547:Colec12 UTSW 18 9840351 missense probably damaging 1.00
Z1088:Colec12 UTSW 18 9848727 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTGCTAAAGAACAGCTTCCTCC -3'
(R):5'- TTCAGTCAAGAGTGGGAAGC -3'

Sequencing Primer
(F):5'- AGAACAGCTTCCTCCATATTTGATC -3'
(R):5'- AGACAAGGAAAGATTGTAGCACGC -3'
Posted On2014-10-02