Incidental Mutation 'R2184:Obsl1'
ID237319
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
MMRRC Submission 040186-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R2184 (G1)
Quality Score219
Status Not validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75502217 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 626 (Q626K)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037330] [ENSMUST00000113565] [ENSMUST00000113567]
Predicted Effect probably benign
Transcript: ENSMUST00000037330
SMART Domains Protein: ENSMUSP00000040310
Gene: ENSMUSG00000032968

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 189 199 N/A INTRINSIC
TGFB 263 366 1.58e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113565
AA Change: Q626K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109195
Gene: ENSMUSG00000026211
AA Change: Q626K

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 5e-57 PDB
Blast:IG_like 622 711 2e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113567
AA Change: Q626K

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: Q626K

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145306
Predicted Effect unknown
Transcript: ENSMUST00000155084
AA Change: Q431K
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211
AA Change: Q431K

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,189 R184G probably damaging Het
2300002M23Rik C A 17: 35,568,218 A151E probably benign Het
A930011G23Rik C T 5: 99,232,369 R339Q possibly damaging Het
Abcd2 T C 15: 91,191,439 Y57C probably benign Het
Adprhl1 A G 8: 13,242,559 V244A probably benign Het
Agl T C 3: 116,780,777 N753D probably benign Het
Amotl1 T A 9: 14,575,390 M440L probably benign Het
Angpt2 A G 8: 18,692,116 Y475H probably benign Het
Angpt4 A T 2: 151,938,954 H374L probably damaging Het
Ank1 A T 8: 23,109,254 T801S probably damaging Het
Ap5m1 G T 14: 49,086,295 A481S probably damaging Het
AY358078 G T 14: 51,825,988 G364W probably damaging Het
C4b C A 17: 34,737,702 A641S probably benign Het
Capn13 T C 17: 73,365,948 Y120C probably damaging Het
Cbx6 T C 15: 79,828,561 T222A probably benign Het
Cckar T C 5: 53,702,912 T192A probably damaging Het
Cdc42bpb T C 12: 111,296,044 D30G probably damaging Het
Cdk18 A G 1: 132,115,952 Y385H probably damaging Het
Cep170 A T 1: 176,756,976 D612E probably benign Het
Dennd4b G T 3: 90,275,540 R888L probably damaging Het
Egf A T 3: 129,723,358 C373* probably null Het
Fam208a T A 14: 27,466,184 N862K possibly damaging Het
Gabrb2 T C 11: 42,421,428 probably null Het
Gle1 G T 2: 29,949,018 A482S probably damaging Het
Gm10644 T C 8: 83,933,627 T30A possibly damaging Het
Gmnn A G 13: 24,753,723 Y95H probably damaging Het
Hectd3 T A 4: 117,000,903 S643T possibly damaging Het
Hoga1 A G 19: 42,061,391 Y225C probably damaging Het
Hook3 T C 8: 26,118,983 E11G probably benign Het
Hsd17b1 C A 11: 101,078,531 S30R probably benign Het
Htr3b G A 9: 48,947,244 P112S probably damaging Het
Iqch T A 9: 63,525,069 D348V probably damaging Het
Irgm2 A T 11: 58,220,428 N327I probably benign Het
Itgb4 T C 11: 115,979,624 I93T probably damaging Het
Lamb2 T C 9: 108,480,553 F92L probably damaging Het
Lats2 T C 14: 57,691,559 H953R probably damaging Het
Lrp1b T C 2: 40,730,702 E3588G probably benign Het
March1 A G 8: 66,387,423 E286G probably benign Het
Mc2r G T 18: 68,408,125 F32L probably benign Het
Mink1 C T 11: 70,603,797 T268M probably damaging Het
Mta1 G A 12: 113,130,195 probably null Het
Muc5b C A 7: 141,858,864 S1849* probably null Het
Myh15 A G 16: 49,137,511 E897G probably damaging Het
Nobox T C 6: 43,304,885 Q418R possibly damaging Het
Olfr1058 G A 2: 86,386,145 T91I probably benign Het
Olfr1137 G A 2: 87,711,205 R234C probably damaging Het
Olfr1502 A G 19: 13,862,035 I81V probably benign Het
Olfr225 T A 11: 59,613,138 M58K probably damaging Het
Olfr340 A G 2: 36,453,034 T150A probably benign Het
Olfr538 T C 7: 140,574,402 V83A probably benign Het
Olfr749 A G 14: 50,736,602 S187P probably damaging Het
Pald1 C T 10: 61,347,136 A345T possibly damaging Het
Pde8b G A 13: 95,026,215 P800S probably damaging Het
Pgm2l1 G A 7: 100,268,155 C493Y possibly damaging Het
Pias3 A G 3: 96,702,221 S311G possibly damaging Het
Pkhd1l1 A G 15: 44,499,296 N573D possibly damaging Het
Pla2g16 A G 19: 7,579,218 D128G probably damaging Het
Plxnc1 T G 10: 94,944,269 S104R probably damaging Het
Pofut2 T A 10: 77,267,225 F179I probably damaging Het
Prkcsh T A 9: 22,004,732 C112S probably damaging Het
Prss32 G A 17: 23,859,323 A328T probably benign Het
Ptgir G T 7: 16,908,783 R103L probably damaging Het
Ptpn5 G A 7: 47,088,602 S244F probably damaging Het
Rnpepl1 G A 1: 92,916,823 V346I probably benign Het
Sh3rf1 T A 8: 61,372,654 V561D probably damaging Het
Slc22a19 A T 19: 7,709,661 Y160N probably benign Het
Sorbs3 A G 14: 70,191,431 probably null Het
Sostdc1 T G 12: 36,317,296 I157S probably damaging Het
Svil G T 18: 5,099,534 R1777L probably damaging Het
Svil A T 18: 5,099,615 E1804V probably damaging Het
Thbs4 A G 13: 92,774,794 S294P probably benign Het
Tle2 A G 10: 81,590,277 Y750C probably damaging Het
Tmcc3 T C 10: 94,582,306 L312P probably damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Tnpo2 T A 8: 85,053,846 M734K probably benign Het
Trmt2a A T 16: 18,252,995 R531W probably benign Het
Ubn2 C T 6: 38,484,094 R483W probably damaging Het
Zc3hav1 T A 6: 38,307,408 Y924F probably damaging Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
PIT4382001:Obsl1 UTSW 1 75487963 missense probably benign 0.06
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1864:Obsl1 UTSW 1 75493109 missense probably benign 0.01
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2069:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4414:Obsl1 UTSW 1 75490902 missense probably benign 0.00
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5757:Obsl1 UTSW 1 75493055 missense probably damaging 0.98
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 unclassified probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense probably benign
R7123:Obsl1 UTSW 1 75489669 missense probably damaging 1.00
R7202:Obsl1 UTSW 1 75489716 missense possibly damaging 0.94
R7291:Obsl1 UTSW 1 75489517 missense probably damaging 0.98
R7305:Obsl1 UTSW 1 75493946 nonsense probably null
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACAGCTTGCAGGATGAGC -3'
(R):5'- ATGTTCGCCCATCTTCTAGC -3'

Sequencing Primer
(F):5'- CCTGTGCTGGAGGCCCTTC -3'
(R):5'- TGGGATATCTATAGAGCCTTCACAGG -3'
Posted On2014-10-02