Incidental Mutation 'R2184:Hectd3'
ID237335
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene NameHECT domain E3 ubiquitin protein ligase 3
Synonyms1700064K09Rik
MMRRC Submission 040186-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R2184 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116995317-117005277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117000903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 643 (S643T)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050067]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050067
AA Change: S643T

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: S643T

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155267
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,189 R184G probably damaging Het
2300002M23Rik C A 17: 35,568,218 A151E probably benign Het
A930011G23Rik C T 5: 99,232,369 R339Q possibly damaging Het
Abcd2 T C 15: 91,191,439 Y57C probably benign Het
Adprhl1 A G 8: 13,242,559 V244A probably benign Het
Agl T C 3: 116,780,777 N753D probably benign Het
Amotl1 T A 9: 14,575,390 M440L probably benign Het
Angpt2 A G 8: 18,692,116 Y475H probably benign Het
Angpt4 A T 2: 151,938,954 H374L probably damaging Het
Ank1 A T 8: 23,109,254 T801S probably damaging Het
Ap5m1 G T 14: 49,086,295 A481S probably damaging Het
AY358078 G T 14: 51,825,988 G364W probably damaging Het
C4b C A 17: 34,737,702 A641S probably benign Het
Capn13 T C 17: 73,365,948 Y120C probably damaging Het
Cbx6 T C 15: 79,828,561 T222A probably benign Het
Cckar T C 5: 53,702,912 T192A probably damaging Het
Cdc42bpb T C 12: 111,296,044 D30G probably damaging Het
Cdk18 A G 1: 132,115,952 Y385H probably damaging Het
Cep170 A T 1: 176,756,976 D612E probably benign Het
Dennd4b G T 3: 90,275,540 R888L probably damaging Het
Egf A T 3: 129,723,358 C373* probably null Het
Fam208a T A 14: 27,466,184 N862K possibly damaging Het
Gabrb2 T C 11: 42,421,428 probably null Het
Gle1 G T 2: 29,949,018 A482S probably damaging Het
Gm10644 T C 8: 83,933,627 T30A possibly damaging Het
Gmnn A G 13: 24,753,723 Y95H probably damaging Het
Hoga1 A G 19: 42,061,391 Y225C probably damaging Het
Hook3 T C 8: 26,118,983 E11G probably benign Het
Hsd17b1 C A 11: 101,078,531 S30R probably benign Het
Htr3b G A 9: 48,947,244 P112S probably damaging Het
Iqch T A 9: 63,525,069 D348V probably damaging Het
Irgm2 A T 11: 58,220,428 N327I probably benign Het
Itgb4 T C 11: 115,979,624 I93T probably damaging Het
Lamb2 T C 9: 108,480,553 F92L probably damaging Het
Lats2 T C 14: 57,691,559 H953R probably damaging Het
Lrp1b T C 2: 40,730,702 E3588G probably benign Het
March1 A G 8: 66,387,423 E286G probably benign Het
Mc2r G T 18: 68,408,125 F32L probably benign Het
Mink1 C T 11: 70,603,797 T268M probably damaging Het
Mta1 G A 12: 113,130,195 probably null Het
Muc5b C A 7: 141,858,864 S1849* probably null Het
Myh15 A G 16: 49,137,511 E897G probably damaging Het
Nobox T C 6: 43,304,885 Q418R possibly damaging Het
Obsl1 G T 1: 75,502,217 Q626K probably benign Het
Olfr1058 G A 2: 86,386,145 T91I probably benign Het
Olfr1137 G A 2: 87,711,205 R234C probably damaging Het
Olfr1502 A G 19: 13,862,035 I81V probably benign Het
Olfr225 T A 11: 59,613,138 M58K probably damaging Het
Olfr340 A G 2: 36,453,034 T150A probably benign Het
Olfr538 T C 7: 140,574,402 V83A probably benign Het
Olfr749 A G 14: 50,736,602 S187P probably damaging Het
Pald1 C T 10: 61,347,136 A345T possibly damaging Het
Pde8b G A 13: 95,026,215 P800S probably damaging Het
Pgm2l1 G A 7: 100,268,155 C493Y possibly damaging Het
Pias3 A G 3: 96,702,221 S311G possibly damaging Het
Pkhd1l1 A G 15: 44,499,296 N573D possibly damaging Het
Pla2g16 A G 19: 7,579,218 D128G probably damaging Het
Plxnc1 T G 10: 94,944,269 S104R probably damaging Het
Pofut2 T A 10: 77,267,225 F179I probably damaging Het
Prkcsh T A 9: 22,004,732 C112S probably damaging Het
Prss32 G A 17: 23,859,323 A328T probably benign Het
Ptgir G T 7: 16,908,783 R103L probably damaging Het
Ptpn5 G A 7: 47,088,602 S244F probably damaging Het
Rnpepl1 G A 1: 92,916,823 V346I probably benign Het
Sh3rf1 T A 8: 61,372,654 V561D probably damaging Het
Slc22a19 A T 19: 7,709,661 Y160N probably benign Het
Sorbs3 A G 14: 70,191,431 probably null Het
Sostdc1 T G 12: 36,317,296 I157S probably damaging Het
Svil G T 18: 5,099,534 R1777L probably damaging Het
Svil A T 18: 5,099,615 E1804V probably damaging Het
Thbs4 A G 13: 92,774,794 S294P probably benign Het
Tle2 A G 10: 81,590,277 Y750C probably damaging Het
Tmcc3 T C 10: 94,582,306 L312P probably damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Tnpo2 T A 8: 85,053,846 M734K probably benign Het
Trmt2a A T 16: 18,252,995 R531W probably benign Het
Ubn2 C T 6: 38,484,094 R483W probably damaging Het
Zc3hav1 T A 6: 38,307,408 Y924F probably damaging Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGCCAAGTATGAGTGGATTG -3'
(R):5'- GGCTCAACAGTGCCATCTTG -3'

Sequencing Primer
(F):5'- GTGAGTAACCCAGTTGTCACC -3'
(R):5'- GAATTAATGCATGTGTGGACCC -3'
Posted On2014-10-02