Incidental Mutation 'R2184:Fam208a'
ID237383
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 040186-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2184 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27466184 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 862 (N862K)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022450
AA Change: N862K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: N862K

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223688
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,189 R184G probably damaging Het
2300002M23Rik C A 17: 35,568,218 A151E probably benign Het
A930011G23Rik C T 5: 99,232,369 R339Q possibly damaging Het
Abcd2 T C 15: 91,191,439 Y57C probably benign Het
Adprhl1 A G 8: 13,242,559 V244A probably benign Het
Agl T C 3: 116,780,777 N753D probably benign Het
Amotl1 T A 9: 14,575,390 M440L probably benign Het
Angpt2 A G 8: 18,692,116 Y475H probably benign Het
Angpt4 A T 2: 151,938,954 H374L probably damaging Het
Ank1 A T 8: 23,109,254 T801S probably damaging Het
Ap5m1 G T 14: 49,086,295 A481S probably damaging Het
AY358078 G T 14: 51,825,988 G364W probably damaging Het
C4b C A 17: 34,737,702 A641S probably benign Het
Capn13 T C 17: 73,365,948 Y120C probably damaging Het
Cbx6 T C 15: 79,828,561 T222A probably benign Het
Cckar T C 5: 53,702,912 T192A probably damaging Het
Cdc42bpb T C 12: 111,296,044 D30G probably damaging Het
Cdk18 A G 1: 132,115,952 Y385H probably damaging Het
Cep170 A T 1: 176,756,976 D612E probably benign Het
Dennd4b G T 3: 90,275,540 R888L probably damaging Het
Egf A T 3: 129,723,358 C373* probably null Het
Gabrb2 T C 11: 42,421,428 probably null Het
Gle1 G T 2: 29,949,018 A482S probably damaging Het
Gm10644 T C 8: 83,933,627 T30A possibly damaging Het
Gmnn A G 13: 24,753,723 Y95H probably damaging Het
Hectd3 T A 4: 117,000,903 S643T possibly damaging Het
Hoga1 A G 19: 42,061,391 Y225C probably damaging Het
Hook3 T C 8: 26,118,983 E11G probably benign Het
Hsd17b1 C A 11: 101,078,531 S30R probably benign Het
Htr3b G A 9: 48,947,244 P112S probably damaging Het
Iqch T A 9: 63,525,069 D348V probably damaging Het
Irgm2 A T 11: 58,220,428 N327I probably benign Het
Itgb4 T C 11: 115,979,624 I93T probably damaging Het
Lamb2 T C 9: 108,480,553 F92L probably damaging Het
Lats2 T C 14: 57,691,559 H953R probably damaging Het
Lrp1b T C 2: 40,730,702 E3588G probably benign Het
March1 A G 8: 66,387,423 E286G probably benign Het
Mc2r G T 18: 68,408,125 F32L probably benign Het
Mink1 C T 11: 70,603,797 T268M probably damaging Het
Mta1 G A 12: 113,130,195 probably null Het
Muc5b C A 7: 141,858,864 S1849* probably null Het
Myh15 A G 16: 49,137,511 E897G probably damaging Het
Nobox T C 6: 43,304,885 Q418R possibly damaging Het
Obsl1 G T 1: 75,502,217 Q626K probably benign Het
Olfr1058 G A 2: 86,386,145 T91I probably benign Het
Olfr1137 G A 2: 87,711,205 R234C probably damaging Het
Olfr1502 A G 19: 13,862,035 I81V probably benign Het
Olfr225 T A 11: 59,613,138 M58K probably damaging Het
Olfr340 A G 2: 36,453,034 T150A probably benign Het
Olfr538 T C 7: 140,574,402 V83A probably benign Het
Olfr749 A G 14: 50,736,602 S187P probably damaging Het
Pald1 C T 10: 61,347,136 A345T possibly damaging Het
Pde8b G A 13: 95,026,215 P800S probably damaging Het
Pgm2l1 G A 7: 100,268,155 C493Y possibly damaging Het
Pias3 A G 3: 96,702,221 S311G possibly damaging Het
Pkhd1l1 A G 15: 44,499,296 N573D possibly damaging Het
Pla2g16 A G 19: 7,579,218 D128G probably damaging Het
Plxnc1 T G 10: 94,944,269 S104R probably damaging Het
Pofut2 T A 10: 77,267,225 F179I probably damaging Het
Prkcsh T A 9: 22,004,732 C112S probably damaging Het
Prss32 G A 17: 23,859,323 A328T probably benign Het
Ptgir G T 7: 16,908,783 R103L probably damaging Het
Ptpn5 G A 7: 47,088,602 S244F probably damaging Het
Rnpepl1 G A 1: 92,916,823 V346I probably benign Het
Sh3rf1 T A 8: 61,372,654 V561D probably damaging Het
Slc22a19 A T 19: 7,709,661 Y160N probably benign Het
Sorbs3 A G 14: 70,191,431 probably null Het
Sostdc1 T G 12: 36,317,296 I157S probably damaging Het
Svil G T 18: 5,099,534 R1777L probably damaging Het
Svil A T 18: 5,099,615 E1804V probably damaging Het
Thbs4 A G 13: 92,774,794 S294P probably benign Het
Tle2 A G 10: 81,590,277 Y750C probably damaging Het
Tmcc3 T C 10: 94,582,306 L312P probably damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Tnpo2 T A 8: 85,053,846 M734K probably benign Het
Trmt2a A T 16: 18,252,995 R531W probably benign Het
Ubn2 C T 6: 38,484,094 R483W probably damaging Het
Zc3hav1 T A 6: 38,307,408 Y924F probably damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAAACACTATTATTTCTGGCTTTGGC -3'
(R):5'- AGATGAAACTCTCCGAGAAACTG -3'

Sequencing Primer
(F):5'- GAACATCTGCTGTGAGGAA -3'
(R):5'- TCTCCGAGAAACTGGTCCTTAAG -3'
Posted On2014-10-02