Incidental Mutation 'R2184:C4b'
ID237396
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 040186-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2184 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34737702 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 641 (A641S)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: A641S

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: A641S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,189 R184G probably damaging Het
2300002M23Rik C A 17: 35,568,218 A151E probably benign Het
A930011G23Rik C T 5: 99,232,369 R339Q possibly damaging Het
Abcd2 T C 15: 91,191,439 Y57C probably benign Het
Adprhl1 A G 8: 13,242,559 V244A probably benign Het
Agl T C 3: 116,780,777 N753D probably benign Het
Amotl1 T A 9: 14,575,390 M440L probably benign Het
Angpt2 A G 8: 18,692,116 Y475H probably benign Het
Angpt4 A T 2: 151,938,954 H374L probably damaging Het
Ank1 A T 8: 23,109,254 T801S probably damaging Het
Ap5m1 G T 14: 49,086,295 A481S probably damaging Het
AY358078 G T 14: 51,825,988 G364W probably damaging Het
Capn13 T C 17: 73,365,948 Y120C probably damaging Het
Cbx6 T C 15: 79,828,561 T222A probably benign Het
Cckar T C 5: 53,702,912 T192A probably damaging Het
Cdc42bpb T C 12: 111,296,044 D30G probably damaging Het
Cdk18 A G 1: 132,115,952 Y385H probably damaging Het
Cep170 A T 1: 176,756,976 D612E probably benign Het
Dennd4b G T 3: 90,275,540 R888L probably damaging Het
Egf A T 3: 129,723,358 C373* probably null Het
Fam208a T A 14: 27,466,184 N862K possibly damaging Het
Gabrb2 T C 11: 42,421,428 probably null Het
Gle1 G T 2: 29,949,018 A482S probably damaging Het
Gm10644 T C 8: 83,933,627 T30A possibly damaging Het
Gmnn A G 13: 24,753,723 Y95H probably damaging Het
Hectd3 T A 4: 117,000,903 S643T possibly damaging Het
Hoga1 A G 19: 42,061,391 Y225C probably damaging Het
Hook3 T C 8: 26,118,983 E11G probably benign Het
Hsd17b1 C A 11: 101,078,531 S30R probably benign Het
Htr3b G A 9: 48,947,244 P112S probably damaging Het
Iqch T A 9: 63,525,069 D348V probably damaging Het
Irgm2 A T 11: 58,220,428 N327I probably benign Het
Itgb4 T C 11: 115,979,624 I93T probably damaging Het
Lamb2 T C 9: 108,480,553 F92L probably damaging Het
Lats2 T C 14: 57,691,559 H953R probably damaging Het
Lrp1b T C 2: 40,730,702 E3588G probably benign Het
March1 A G 8: 66,387,423 E286G probably benign Het
Mc2r G T 18: 68,408,125 F32L probably benign Het
Mink1 C T 11: 70,603,797 T268M probably damaging Het
Mta1 G A 12: 113,130,195 probably null Het
Muc5b C A 7: 141,858,864 S1849* probably null Het
Myh15 A G 16: 49,137,511 E897G probably damaging Het
Nobox T C 6: 43,304,885 Q418R possibly damaging Het
Obsl1 G T 1: 75,502,217 Q626K probably benign Het
Olfr1058 G A 2: 86,386,145 T91I probably benign Het
Olfr1137 G A 2: 87,711,205 R234C probably damaging Het
Olfr1502 A G 19: 13,862,035 I81V probably benign Het
Olfr225 T A 11: 59,613,138 M58K probably damaging Het
Olfr340 A G 2: 36,453,034 T150A probably benign Het
Olfr538 T C 7: 140,574,402 V83A probably benign Het
Olfr749 A G 14: 50,736,602 S187P probably damaging Het
Pald1 C T 10: 61,347,136 A345T possibly damaging Het
Pde8b G A 13: 95,026,215 P800S probably damaging Het
Pgm2l1 G A 7: 100,268,155 C493Y possibly damaging Het
Pias3 A G 3: 96,702,221 S311G possibly damaging Het
Pkhd1l1 A G 15: 44,499,296 N573D possibly damaging Het
Pla2g16 A G 19: 7,579,218 D128G probably damaging Het
Plxnc1 T G 10: 94,944,269 S104R probably damaging Het
Pofut2 T A 10: 77,267,225 F179I probably damaging Het
Prkcsh T A 9: 22,004,732 C112S probably damaging Het
Prss32 G A 17: 23,859,323 A328T probably benign Het
Ptgir G T 7: 16,908,783 R103L probably damaging Het
Ptpn5 G A 7: 47,088,602 S244F probably damaging Het
Rnpepl1 G A 1: 92,916,823 V346I probably benign Het
Sh3rf1 T A 8: 61,372,654 V561D probably damaging Het
Slc22a19 A T 19: 7,709,661 Y160N probably benign Het
Sorbs3 A G 14: 70,191,431 probably null Het
Sostdc1 T G 12: 36,317,296 I157S probably damaging Het
Svil G T 18: 5,099,534 R1777L probably damaging Het
Svil A T 18: 5,099,615 E1804V probably damaging Het
Thbs4 A G 13: 92,774,794 S294P probably benign Het
Tle2 A G 10: 81,590,277 Y750C probably damaging Het
Tmcc3 T C 10: 94,582,306 L312P probably damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Tnpo2 T A 8: 85,053,846 M734K probably benign Het
Trmt2a A T 16: 18,252,995 R531W probably benign Het
Ubn2 C T 6: 38,484,094 R483W probably damaging Het
Zc3hav1 T A 6: 38,307,408 Y924F probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACATCCCTCCATGGCCT -3'
(R):5'- CCCAGTCTTCCCTTGAATCCTAG -3'

Sequencing Primer
(F):5'- GACTTCCTTTAGTGATGAACAGCAG -3'
(R):5'- CCCTTGAATCCTAGATGTTCTTGG -3'
Posted On2014-10-02