Incidental Mutation 'R2170:Atxn2l'
ID237430
Institutional Source Beutler Lab
Gene Symbol Atxn2l
Ensembl Gene ENSMUSG00000032637
Gene Nameataxin 2-like
SynonymsA2lp, A2D, A2RP, A2LG
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R2170 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location126491708-126503437 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 126503239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000179818] [ENSMUST00000206577]
Predicted Effect probably benign
Transcript: ENSMUST00000040202
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166682
SMART Domains Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 1 69 1.6e-21 PFAM
LsmAD 142 211 1.95e-28 SMART
low complexity region 237 262 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
Pfam:PAM2 537 553 4.3e-8 PFAM
low complexity region 561 577 N/A INTRINSIC
low complexity region 644 667 N/A INTRINSIC
low complexity region 800 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167759
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179818
SMART Domains Protein: ENSMUSP00000137108
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 62 132 4.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,157 S404P probably damaging Het
4933434E20Rik T A 3: 90,056,304 L89Q probably benign Het
9330182L06Rik A G 5: 9,479,206 D221G probably damaging Het
AI481877 A G 4: 59,069,215 L737S possibly damaging Het
Bcl6 A G 16: 23,974,930 F89S probably damaging Het
Ccr1l1 C A 9: 123,978,135 V92F possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Chrne T C 11: 70,618,497 N86S probably damaging Het
Copg2 CCTCATC CC 6: 30,812,822 probably null Het
Eps8l2 T C 7: 141,342,071 S21P probably benign Het
Glb1 CCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 9: 114,473,805 probably benign Het
Gm8251 A T 1: 44,056,008 S1977T probably benign Het
Gngt2 A G 11: 95,837,245 probably benign Het
Hecw2 T A 1: 53,942,797 E135V probably damaging Het
Hmcn2 G A 2: 31,380,281 A1177T probably benign Het
Itga10 T C 3: 96,650,457 V272A probably damaging Het
Kif17 A G 4: 138,288,371 I418M probably benign Het
Knl1 T C 2: 119,087,594 probably null Het
Lamc1 C T 1: 153,249,142 A628T probably benign Het
Mag A T 7: 30,908,987 L234* probably null Het
Muc5ac T A 7: 141,812,347 V2080E possibly damaging Het
Myo18b T C 5: 112,723,858 D2119G probably benign Het
Ncam1 C T 9: 49,798,681 A17T probably benign Het
Nipbl A G 15: 8,293,218 Y2570H probably damaging Het
Oasl2 T C 5: 114,906,800 V129A probably damaging Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr298 T A 7: 86,488,570 H327L probably benign Het
Podn A T 4: 108,022,533 L85Q probably damaging Het
Ppp1r12c A T 7: 4,482,806 D680E possibly damaging Het
Prdm14 G A 1: 13,122,460 L352F probably damaging Het
Prob1 G T 18: 35,654,737 Q155K probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Stard5 A G 7: 83,633,158 T60A probably benign Het
Syt7 A G 19: 10,439,380 K402E probably damaging Het
Tll2 T A 19: 41,183,275 D69V probably damaging Het
Vmn1r40 T C 6: 89,714,975 F258S probably benign Het
Zfp759 T A 13: 67,136,748 Y19N possibly damaging Het
Other mutations in Atxn2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Atxn2l APN 7 126498288 missense possibly damaging 0.94
IGL00507:Atxn2l APN 7 126496584 missense possibly damaging 0.51
IGL00846:Atxn2l APN 7 126499178 missense probably damaging 1.00
IGL01813:Atxn2l APN 7 126500253 missense probably damaging 1.00
R0005:Atxn2l UTSW 7 126498274 missense probably damaging 1.00
R0267:Atxn2l UTSW 7 126493207 missense probably damaging 1.00
R0608:Atxn2l UTSW 7 126501416 splice site probably null
R0749:Atxn2l UTSW 7 126500837 missense possibly damaging 0.50
R0831:Atxn2l UTSW 7 126499160 missense probably damaging 1.00
R0881:Atxn2l UTSW 7 126496596 missense probably damaging 1.00
R1022:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1024:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1081:Atxn2l UTSW 7 126494212 missense probably damaging 1.00
R1132:Atxn2l UTSW 7 126494248 small deletion probably benign
R1489:Atxn2l UTSW 7 126496467 missense probably damaging 1.00
R1919:Atxn2l UTSW 7 126493168 missense probably damaging 0.99
R2062:Atxn2l UTSW 7 126495866 missense probably damaging 1.00
R3719:Atxn2l UTSW 7 126498130 missense probably damaging 1.00
R3861:Atxn2l UTSW 7 126501951 critical splice donor site probably null
R5061:Atxn2l UTSW 7 126500203 missense probably damaging 1.00
R6022:Atxn2l UTSW 7 126496435 critical splice donor site probably null
R6075:Atxn2l UTSW 7 126492517 missense possibly damaging 0.70
R6131:Atxn2l UTSW 7 126503165 unclassified probably benign
R6460:Atxn2l UTSW 7 126494248 small deletion probably benign
R6552:Atxn2l UTSW 7 126493821 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TAAGATGCTTTCGGCTCCG -3'
(R):5'- TTTAAGGTGGCTCAGAACCTAG -3'

Sequencing Primer
(F):5'- CCAGGCACGGAGAGACC -3'
(R):5'- GGAACTAACCGCCTGGC -3'
Posted On2014-10-02