Incidental Mutation 'R2171:Itga6'
ID237458
Institutional Source Beutler Lab
Gene Symbol Itga6
Ensembl Gene ENSMUSG00000027111
Gene Nameintegrin alpha 6
SynonymsCd49f, 5033401O05Rik
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71745616-71858416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71820014 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 135 (Y135N)
Ref Sequence ENSEMBL: ENSMUSP00000107729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028522] [ENSMUST00000112101]
Predicted Effect probably damaging
Transcript: ENSMUST00000028522
AA Change: Y135N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028522
Gene: ENSMUSG00000027111
AA Change: Y135N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 5e-32 SMART
SCOP:d1m1xa3 797 1017 3e-55 SMART
Pfam:Integrin_alpha 1038 1052 3.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112101
AA Change: Y135N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107729
Gene: ENSMUSG00000027111
AA Change: Y135N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 4e-32 SMART
SCOP:d1m1xa3 797 1017 4e-55 SMART
low complexity region 1058 1070 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152009
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 4 to bind laminin and to form the main component of hemidesmosomes, which mediate attachment of epithelia to basement membranes. In mouse, deficiency of this gene is associated with absence of hemidesmosomes, severe skin blistering, and early post-natal death. In humans mutations of this gene are associated with epidermolysis bullosa. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe blistering of the skin and other epithelia, absence of hemidesmosomes, altered laminin deposition in brain, and ectopic neuroblastic outgrowths on the brain and in the eye. Mutants die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Itga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Itga6 APN 2 71838262 splice site probably null
IGL00902:Itga6 APN 2 71849394 missense probably benign 0.39
IGL01360:Itga6 APN 2 71787326 splice site probably null
IGL01621:Itga6 APN 2 71825656 missense probably benign 0.02
IGL01877:Itga6 APN 2 71838280 missense probably benign
IGL02332:Itga6 APN 2 71838373 missense possibly damaging 0.63
IGL02556:Itga6 APN 2 71838683 missense probably benign 0.20
IGL02713:Itga6 APN 2 71816713 missense possibly damaging 0.79
IGL02811:Itga6 APN 2 71826732 missense probably damaging 0.98
IGL03171:Itga6 APN 2 71841329 critical splice donor site probably null
isle_royale UTSW 2 71787233 missense probably benign 0.04
PIT4418001:Itga6 UTSW 2 71834070 missense probably benign 0.06
R0070:Itga6 UTSW 2 71826716 unclassified probably benign
R0611:Itga6 UTSW 2 71820060 missense possibly damaging 0.84
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1439:Itga6 UTSW 2 71834034 missense probably damaging 1.00
R1487:Itga6 UTSW 2 71843240 missense possibly damaging 0.87
R1713:Itga6 UTSW 2 71787202 missense probably benign
R1720:Itga6 UTSW 2 71820166 missense probably damaging 1.00
R1816:Itga6 UTSW 2 71840809 missense probably benign 0.00
R1866:Itga6 UTSW 2 71834070 missense probably benign
R2009:Itga6 UTSW 2 71816681 missense probably benign 0.26
R2018:Itga6 UTSW 2 71818484 missense probably benign 0.16
R2189:Itga6 UTSW 2 71825617 missense probably benign 0.00
R2289:Itga6 UTSW 2 71818529 missense probably damaging 0.99
R2399:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R4437:Itga6 UTSW 2 71825638 missense probably benign 0.42
R4482:Itga6 UTSW 2 71855915 missense probably damaging 1.00
R4773:Itga6 UTSW 2 71822444 missense probably benign 0.13
R4786:Itga6 UTSW 2 71838690 missense possibly damaging 0.80
R4898:Itga6 UTSW 2 71838373 missense possibly damaging 0.77
R5074:Itga6 UTSW 2 71826435 missense probably benign
R5386:Itga6 UTSW 2 71841150 missense probably damaging 1.00
R5591:Itga6 UTSW 2 71840590 missense probably damaging 1.00
R6024:Itga6 UTSW 2 71787233 missense probably benign 0.04
R6174:Itga6 UTSW 2 71833709 missense possibly damaging 0.88
R6210:Itga6 UTSW 2 71834007 critical splice acceptor site probably null
R6432:Itga6 UTSW 2 71833772 missense possibly damaging 0.75
R6644:Itga6 UTSW 2 71841124 missense probably damaging 1.00
R7354:Itga6 UTSW 2 71820230 missense probably damaging 1.00
R7402:Itga6 UTSW 2 71853553 missense probably benign 0.05
R7479:Itga6 UTSW 2 71838336 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGCGTTCCAGTTCTGTCAAG -3'
(R):5'- TTGCTGACAGGAGCCAAAC -3'

Sequencing Primer
(F):5'- AGAGGGCATTGGGTCCCATTAC -3'
(R):5'- GGAGCCAAACTTTTCATGGC -3'
Posted On2014-10-02