Incidental Mutation 'R2171:Spty2d1'
ID237484
Institutional Source Beutler Lab
Gene Symbol Spty2d1
Ensembl Gene ENSMUSG00000049516
Gene NameSPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Synonyms5830435K17Rik
MMRRC Submission 040173-MU
Accession Numbers

Genbank: NM_175318; MGI: 2142062

Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R2171 (G1)
Quality Score223
Status Not validated
Chromosome7
Chromosomal Location46990396-47008411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46994613 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 636 (R636H)
Ref Sequence ENSEMBL: ENSMUSP00000059457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061639]
Predicted Effect probably damaging
Transcript: ENSMUST00000061639
AA Change: R636H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059457
Gene: ENSMUSG00000049516
AA Change: R636H

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
coiled coil region 45 82 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 199 215 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
internal_repeat_1 283 336 4.09e-5 PROSPERO
low complexity region 338 353 N/A INTRINSIC
internal_repeat_1 366 420 4.09e-5 PROSPERO
low complexity region 434 468 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
SPT2 573 680 1.3e-32 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Spty2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Spty2d1 APN 7 46998987 missense probably damaging 1.00
IGL01763:Spty2d1 APN 7 46999848 missense probably damaging 0.99
IGL01988:Spty2d1 APN 7 46997610 missense probably damaging 0.99
IGL02149:Spty2d1 APN 7 47008144 utr 5 prime probably benign
IGL02236:Spty2d1 APN 7 46997612 missense probably benign 0.02
IGL02273:Spty2d1 APN 7 46997573 missense probably damaging 0.97
3-1:Spty2d1 UTSW 7 46998677 missense probably damaging 1.00
R0184:Spty2d1 UTSW 7 46997574 missense possibly damaging 0.94
R0201:Spty2d1 UTSW 7 46997901 nonsense probably null
R1592:Spty2d1 UTSW 7 46998889 missense possibly damaging 0.56
R2116:Spty2d1 UTSW 7 46996185 missense probably damaging 1.00
R2898:Spty2d1 UTSW 7 46993352 missense unknown
R3857:Spty2d1 UTSW 7 46998296 missense probably benign 0.04
R4080:Spty2d1 UTSW 7 46998581 missense probably damaging 0.99
R4319:Spty2d1 UTSW 7 46998135 missense probably damaging 0.99
R4732:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R4733:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R5317:Spty2d1 UTSW 7 46998301 missense possibly damaging 0.61
R5485:Spty2d1 UTSW 7 46997885 missense possibly damaging 0.76
R5711:Spty2d1 UTSW 7 46998097 missense possibly damaging 0.84
R5761:Spty2d1 UTSW 7 46998284 missense probably damaging 1.00
R6418:Spty2d1 UTSW 7 46998003 missense probably damaging 1.00
R7182:Spty2d1 UTSW 7 46998523 missense probably benign 0.09
R7372:Spty2d1 UTSW 7 46998944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAGAAAGGCAGGGAGTC -3'
(R):5'- TGAGAGGCTGTAGCTCTTTAAG -3'

Sequencing Primer
(F):5'- AGTCTGTCTGCGGCCTTTATAGC -3'
(R):5'- AGAGGATCTCTTGAGTTCAATGC -3'
Posted On2014-10-02