Incidental Mutation 'R2171:Bccip'
ID237488
Institutional Source Beutler Lab
Gene Symbol Bccip
Ensembl Gene ENSMUSG00000030983
Gene NameBRCA2 and CDKN1A interacting protein
SynonymsTOK-1, 1110013J05Rik
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location133709333-133721145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133719114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 206 (S206P)
Ref Sequence ENSEMBL: ENSMUSP00000033282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033282] [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
Predicted Effect probably benign
Transcript: ENSMUST00000033282
AA Change: S206P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033282
Gene: ENSMUSG00000030983
AA Change: S206P

DomainStartEndE-ValueType
Pfam:BCIP 58 258 2.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033290
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063669
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106139
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Bccip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Bccip APN 7 133709376 missense probably benign 0.20
IGL03345:Bccip APN 7 133709491 missense probably benign
R0071:Bccip UTSW 7 133714231 missense probably damaging 1.00
R0071:Bccip UTSW 7 133714231 missense probably damaging 1.00
R0514:Bccip UTSW 7 133719130 missense possibly damaging 0.80
R4435:Bccip UTSW 7 133719213 missense probably benign 0.00
R4626:Bccip UTSW 7 133720728 missense possibly damaging 0.92
R4648:Bccip UTSW 7 133714899 missense probably damaging 1.00
R5055:Bccip UTSW 7 133714923 missense probably benign 0.13
R5658:Bccip UTSW 7 133717620 missense possibly damaging 0.58
R5986:Bccip UTSW 7 133720865 missense probably benign 0.38
R6328:Bccip UTSW 7 133717774 missense probably damaging 0.97
R6818:Bccip UTSW 7 133717759 missense probably damaging 1.00
R6934:Bccip UTSW 7 133720791 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTATAGCAAAGCCCAGGC -3'
(R):5'- ACAGTGTGTTAGCAAGCAGC -3'

Sequencing Primer
(F):5'- GGCTCATCACATTCTTGGATATAGC -3'
(R):5'- CAGGCTGGCTTCAACTTAGAGATC -3'
Posted On2014-10-02