Incidental Mutation 'R2172:Map1a'
ID237526
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Namemicrotubule-associated protein 1 A
SynonymsMtap1, Mtap-1, 6330416M19Rik, Mtap1a
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121289600-121310832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121307932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 2726 (V2726L)
Ref Sequence ENSEMBL: ENSMUSP00000106269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]
Predicted Effect probably benign
Transcript: ENSMUST00000052029
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094639
AA Change: V2964L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: V2964L

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110626
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110639
AA Change: V2726L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: V2726L

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133283
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121299027 missense probably damaging 0.99
IGL00826:Map1a APN 2 121302276 missense possibly damaging 0.87
IGL01476:Map1a APN 2 121305207 missense probably damaging 1.00
IGL02029:Map1a APN 2 121303298 missense possibly damaging 0.57
IGL02100:Map1a APN 2 121302846 missense probably damaging 0.99
IGL02136:Map1a APN 2 121300212 missense probably damaging 1.00
IGL02146:Map1a APN 2 121299446 missense probably damaging 1.00
IGL02264:Map1a APN 2 121307313 missense probably damaging 1.00
IGL02456:Map1a APN 2 121298653 missense probably damaging 1.00
IGL02485:Map1a APN 2 121299288 missense probably damaging 1.00
IGL02535:Map1a APN 2 121302177 nonsense probably null
IGL02628:Map1a APN 2 121300104 missense probably damaging 1.00
IGL02721:Map1a APN 2 121304037 missense probably benign 0.44
IGL03273:Map1a APN 2 121300238 missense probably damaging 1.00
IGL03281:Map1a APN 2 121305060 missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121301610 missense probably damaging 0.99
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0096:Map1a UTSW 2 121301505 missense probably damaging 1.00
R0218:Map1a UTSW 2 121305425 missense probably benign 0.00
R0363:Map1a UTSW 2 121302044 missense probably damaging 1.00
R0450:Map1a UTSW 2 121305774 missense probably benign 0.27
R0469:Map1a UTSW 2 121305774 missense probably benign 0.27
R0477:Map1a UTSW 2 121302101 missense probably damaging 1.00
R0504:Map1a UTSW 2 121302941 missense probably benign 0.03
R0510:Map1a UTSW 2 121305774 missense probably benign 0.27
R0521:Map1a UTSW 2 121305753 missense probably damaging 1.00
R0601:Map1a UTSW 2 121298602 missense probably damaging 1.00
R0619:Map1a UTSW 2 121305255 missense probably damaging 0.96
R0633:Map1a UTSW 2 121308014 missense probably damaging 1.00
R0652:Map1a UTSW 2 121302783 missense probably benign 0.04
R0893:Map1a UTSW 2 121300533 missense probably damaging 1.00
R0960:Map1a UTSW 2 121301643 missense probably benign 0.16
R1115:Map1a UTSW 2 121307378 splice site probably null
R1166:Map1a UTSW 2 121300260 missense probably damaging 1.00
R1326:Map1a UTSW 2 121306190 nonsense probably null
R1331:Map1a UTSW 2 121306220 nonsense probably null
R1395:Map1a UTSW 2 121303925 missense probably benign 0.26
R1489:Map1a UTSW 2 121300437 missense possibly damaging 0.91
R1573:Map1a UTSW 2 121304126 missense probably benign 0.37
R1596:Map1a UTSW 2 121289765 missense probably benign 0.00
R1662:Map1a UTSW 2 121306408 missense possibly damaging 0.90
R1675:Map1a UTSW 2 121302655 nonsense probably null
R1919:Map1a UTSW 2 121307012 missense probably damaging 1.00
R2122:Map1a UTSW 2 121299446 missense probably damaging 1.00
R2126:Map1a UTSW 2 121298641 missense probably damaging 0.96
R2143:Map1a UTSW 2 121301945 missense probably damaging 1.00
R2249:Map1a UTSW 2 121300287 missense probably damaging 1.00
R2254:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R2255:Map1a UTSW 2 121303791 missense possibly damaging 0.71
R3834:Map1a UTSW 2 121307322 missense probably damaging 1.00
R4011:Map1a UTSW 2 121300127 missense probably damaging 1.00
R4346:Map1a UTSW 2 121301325 missense probably benign 0.13
R4842:Map1a UTSW 2 121302086 missense probably damaging 1.00
R4933:Map1a UTSW 2 121305905 missense probably damaging 1.00
R4978:Map1a UTSW 2 121301142 missense probably benign 0.00
R4988:Map1a UTSW 2 121303050 missense probably benign 0.34
R5026:Map1a UTSW 2 121307538 missense possibly damaging 0.83
R5086:Map1a UTSW 2 121304504 missense probably damaging 1.00
R5155:Map1a UTSW 2 121302386 missense probably damaging 1.00
R5232:Map1a UTSW 2 121301985 missense probably damaging 1.00
R5311:Map1a UTSW 2 121302387 missense probably damaging 1.00
R5401:Map1a UTSW 2 121299672 missense probably damaging 1.00
R5465:Map1a UTSW 2 121306025 missense probably damaging 1.00
R5526:Map1a UTSW 2 121305662 missense probably damaging 1.00
R5642:Map1a UTSW 2 121306043 missense probably damaging 1.00
R5726:Map1a UTSW 2 121305065 missense probably damaging 1.00
R5817:Map1a UTSW 2 121298910 missense possibly damaging 0.81
R5855:Map1a UTSW 2 121303674 missense possibly damaging 0.74
R5917:Map1a UTSW 2 121305216 missense probably damaging 1.00
R5974:Map1a UTSW 2 121304376 missense probably benign 0.20
R5987:Map1a UTSW 2 121304295 missense possibly damaging 0.56
R6151:Map1a UTSW 2 121289823 missense probably benign 0.12
R6406:Map1a UTSW 2 121300743 missense probably damaging 1.00
R7014:Map1a UTSW 2 121300239 missense probably damaging 1.00
R7099:Map1a UTSW 2 121300517 missense probably benign 0.04
R7211:Map1a UTSW 2 121304643 missense probably benign 0.02
R7230:Map1a UTSW 2 121300818 missense probably damaging 1.00
R7305:Map1a UTSW 2 121299458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTAGAATCTGGTCAAAGCTCTG -3'
(R):5'- GACTCAGCAGTAGCCATTCTC -3'

Sequencing Primer
(F):5'- ATCTGGTCAAAGCTCTGTCAGAGG -3'
(R):5'- CTCAGCAGTAGCCATTCTCTAAATG -3'
Posted On2014-10-02