Incidental Mutation 'R2172:Arfip2'
ID237554
Institutional Source Beutler Lab
Gene Symbol Arfip2
Ensembl Gene ENSMUSG00000030881
Gene NameADP-ribosylation factor interacting protein 2
Synonyms2310002N04Rik, Arfaptin 2
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105634203-105640416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105637988 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 64 (D64V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033171] [ENSMUST00000057525] [ENSMUST00000058333] [ENSMUST00000084782] [ENSMUST00000106780] [ENSMUST00000106783] [ENSMUST00000106784] [ENSMUST00000106785] [ENSMUST00000106786] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000131446] [ENSMUST00000133519] [ENSMUST00000137931] [ENSMUST00000140577] [ENSMUST00000142363] [ENSMUST00000142874] [ENSMUST00000147044] [ENSMUST00000149819] [ENSMUST00000150479] [ENSMUST00000151193] [ENSMUST00000153371] [ENSMUST00000157028] [ENSMUST00000209445] [ENSMUST00000209550] [ENSMUST00000209588] [ENSMUST00000210312] [ENSMUST00000210350] [ENSMUST00000210911] [ENSMUST00000211054]
Predicted Effect probably benign
Transcript: ENSMUST00000033171
SMART Domains Protein: ENSMUSP00000033171
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057525
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058333
SMART Domains Protein: ENSMUSP00000057061
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082963
Predicted Effect probably damaging
Transcript: ENSMUST00000084782
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081840
Gene: ENSMUSG00000030881
AA Change: D123V

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106780
SMART Domains Protein: ENSMUSP00000102392
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106783
SMART Domains Protein: ENSMUSP00000102395
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106784
Predicted Effect probably benign
Transcript: ENSMUST00000106785
SMART Domains Protein: ENSMUSP00000102397
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106786
SMART Domains Protein: ENSMUSP00000102398
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 3 66 3.6e-18 PFAM
low complexity region 89 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106789
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127853
Predicted Effect probably damaging
Transcript: ENSMUST00000131446
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120387
Gene: ENSMUSG00000030881
AA Change: D123V

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133519
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121649
Gene: ENSMUSG00000030881
AA Change: D123V

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 209 5.49e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134613
Predicted Effect probably damaging
Transcript: ENSMUST00000137931
AA Change: D123V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118616
Gene: ENSMUSG00000030881
AA Change: D123V

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Pfam:Arfaptin 89 153 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140385
Predicted Effect probably benign
Transcript: ENSMUST00000140577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142173
Predicted Effect probably benign
Transcript: ENSMUST00000142363
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000147044
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149819
Predicted Effect probably benign
Transcript: ENSMUST00000150479
Predicted Effect probably benign
Transcript: ENSMUST00000151193
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000157028
Predicted Effect probably benign
Transcript: ENSMUST00000209445
Predicted Effect probably damaging
Transcript: ENSMUST00000209550
AA Change: D119V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209588
Predicted Effect probably damaging
Transcript: ENSMUST00000209870
AA Change: D64V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210312
Predicted Effect probably benign
Transcript: ENSMUST00000210350
Predicted Effect probably benign
Transcript: ENSMUST00000210893
Predicted Effect probably benign
Transcript: ENSMUST00000210911
Predicted Effect probably benign
Transcript: ENSMUST00000211054
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Arfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Arfip2 APN 7 105639383 missense probably damaging 1.00
IGL03192:Arfip2 APN 7 105637943 missense probably damaging 1.00
IGL03299:Arfip2 APN 7 105637943 missense probably damaging 1.00
R0096:Arfip2 UTSW 7 105638230 missense probably damaging 1.00
R0121:Arfip2 UTSW 7 105636371 missense probably damaging 1.00
R0130:Arfip2 UTSW 7 105638998 unclassified probably benign
R0152:Arfip2 UTSW 7 105637223 missense probably damaging 1.00
R0317:Arfip2 UTSW 7 105637223 missense probably damaging 1.00
R4419:Arfip2 UTSW 7 105639063 missense probably damaging 1.00
R4926:Arfip2 UTSW 7 105637944 missense probably damaging 1.00
R5394:Arfip2 UTSW 7 105636976 nonsense probably null
R5637:Arfip2 UTSW 7 105637163 missense probably damaging 1.00
Z1088:Arfip2 UTSW 7 105637242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGCTGAGGCACCTGAAG -3'
(R):5'- TAAGATTCAAGTGCTTCTCCTCAG -3'

Sequencing Primer
(F):5'- ACCTGAAGCTCTGGGGACTTC -3'
(R):5'- CCTTCCAATCAGTGCACA -3'
Posted On2014-10-02