Incidental Mutation 'R2172:Olfr478'
ID237555
Institutional Source Beutler Lab
Gene Symbol Olfr478
Ensembl Gene ENSMUSG00000094426
Gene Nameolfactory receptor 478
SynonymsGA_x6K02T2PBJ9-10361879-10360935, MOR204-13
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108029965-108033989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108031467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 292 (I292N)
Ref Sequence ENSEMBL: ENSMUSP00000147713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049719] [ENSMUST00000210173]
Predicted Effect probably damaging
Transcript: ENSMUST00000049719
AA Change: I292N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058931
Gene: ENSMUSG00000094426
AA Change: I292N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.1e-54 PFAM
Pfam:7tm_1 44 293 1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210173
AA Change: I292N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Olfr478
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr478 APN 7 108031680 missense probably damaging 1.00
IGL01457:Olfr478 APN 7 108032121 missense possibly damaging 0.90
IGL03156:Olfr478 APN 7 108032351 utr 5 prime probably benign
IGL03271:Olfr478 APN 7 108031507 missense probably damaging 0.96
IGL03399:Olfr478 APN 7 108031582 missense probably benign 0.02
R0660:Olfr478 UTSW 7 108031615 missense probably damaging 1.00
R0722:Olfr478 UTSW 7 108032334 missense probably benign 0.00
R1468:Olfr478 UTSW 7 108032388 intron probably null
R1468:Olfr478 UTSW 7 108032388 intron probably null
R4274:Olfr478 UTSW 7 108031544 missense probably benign 0.01
R5164:Olfr478 UTSW 7 108032280 missense possibly damaging 0.47
R5501:Olfr478 UTSW 7 108032153 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCAGCAGAGTTACTTCATG -3'
(R):5'- TCTTGAAGATGCACTCCACTGAG -3'

Sequencing Primer
(F):5'- TTCATGAGAAGCAGTCTTAGGAAGTG -3'
(R):5'- CTCCACTGAGGGTCGACAGAAG -3'
Posted On2014-10-02