Incidental Mutation 'R2172:Skor1'
ID237564
Institutional Source Beutler Lab
Gene Symbol Skor1
Ensembl Gene ENSMUSG00000022245
Gene NameSKI family transcriptional corepressor 1
SynonymsCorl1, C230094B15Rik, Lbxcor1
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R2172 (G1)
Quality Score123
Status Not validated
Chromosome9
Chromosomal Location63138170-63148961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63145122 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 494 (A494S)
Ref Sequence ENSEMBL: ENSMUSP00000113924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055281] [ENSMUST00000116613] [ENSMUST00000119146]
Predicted Effect probably benign
Transcript: ENSMUST00000055281
AA Change: A522S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055037
Gene: ENSMUSG00000022245
AA Change: A522S

DomainStartEndE-ValueType
Pfam:Ski_Sno 61 168 3.2e-41 PFAM
c-SKI_SMAD_bind 180 272 2.48e-56 SMART
low complexity region 284 312 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
low complexity region 345 366 N/A INTRINSIC
low complexity region 379 398 N/A INTRINSIC
low complexity region 414 454 N/A INTRINSIC
low complexity region 465 479 N/A INTRINSIC
low complexity region 502 525 N/A INTRINSIC
low complexity region 568 582 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
SCOP:d1eq1a_ 850 937 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116613
AA Change: A483S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112312
Gene: ENSMUSG00000022245
AA Change: A483S

DomainStartEndE-ValueType
Pfam:Ski_Sno 17 130 3.5e-42 PFAM
c-SKI_SMAD_bind 141 233 2.48e-56 SMART
low complexity region 245 273 N/A INTRINSIC
low complexity region 294 303 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
low complexity region 340 359 N/A INTRINSIC
low complexity region 375 415 N/A INTRINSIC
low complexity region 426 440 N/A INTRINSIC
low complexity region 463 486 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
SCOP:d1eq1a_ 811 898 1e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119146
AA Change: A494S

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113924
Gene: ENSMUSG00000022245
AA Change: A494S

DomainStartEndE-ValueType
Pfam:Ski_Sno 28 141 3e-42 PFAM
c-SKI_SMAD_bind 152 244 2.48e-56 SMART
low complexity region 256 284 N/A INTRINSIC
low complexity region 305 314 N/A INTRINSIC
low complexity region 317 338 N/A INTRINSIC
low complexity region 351 370 N/A INTRINSIC
low complexity region 386 426 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
low complexity region 474 497 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
SCOP:d1eq1a_ 822 909 1e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Skor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Skor1 APN 9 63146441 missense probably damaging 1.00
IGL00736:Skor1 APN 9 63139538 missense probably damaging 0.99
IGL01344:Skor1 APN 9 63142278 missense possibly damaging 0.79
IGL01383:Skor1 APN 9 63146556 missense probably benign 0.12
IGL01456:Skor1 APN 9 63145490 missense probably damaging 1.00
IGL02503:Skor1 APN 9 63146115 missense probably damaging 1.00
IGL02526:Skor1 APN 9 63145877 missense probably damaging 1.00
IGL02699:Skor1 APN 9 63140046 splice site probably benign
R0041:Skor1 UTSW 9 63145851 missense probably damaging 1.00
R0092:Skor1 UTSW 9 63145995 missense probably damaging 1.00
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1464:Skor1 UTSW 9 63140111 missense possibly damaging 0.54
R1581:Skor1 UTSW 9 63146223 missense probably damaging 1.00
R1598:Skor1 UTSW 9 63146004 missense probably damaging 1.00
R3734:Skor1 UTSW 9 63140068 missense probably damaging 1.00
R3803:Skor1 UTSW 9 63145586 missense probably benign 0.06
R3839:Skor1 UTSW 9 63144448 missense probably damaging 0.97
R4627:Skor1 UTSW 9 63145476 missense probably damaging 1.00
R4698:Skor1 UTSW 9 63144548 missense probably benign
R4712:Skor1 UTSW 9 63139573 splice site probably null
R4781:Skor1 UTSW 9 63144459 missense probably benign
R5089:Skor1 UTSW 9 63145923 missense probably damaging 0.99
R5735:Skor1 UTSW 9 63146064 missense probably damaging 1.00
R6279:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6300:Skor1 UTSW 9 63145314 missense probably damaging 0.99
R6396:Skor1 UTSW 9 63144950 missense probably damaging 1.00
R6791:Skor1 UTSW 9 63140354 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTGACACGTAGGAGCTTTTG -3'
(R):5'- TTCTGGGGACATCAACCTTCC -3'

Sequencing Primer
(F):5'- CTTTTGCGAGCAGGTGGC -3'
(R):5'- ATCAACCTTCCGGCGCAG -3'
Posted On2014-10-02