Incidental Mutation 'R2172:Bsn'
ID237565
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 040174-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 108109992 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: T2854A
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: T2854A

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGTCAGACGTCCATTG -3'
(R):5'- TAAGTCTCCACAAGTGCTCTAC -3'

Sequencing Primer
(F):5'- CTTTGGAGCCAGAGGTGAC -3'
(R):5'- ACAAGTGCTCTACTCTCCAGTG -3'
Posted On2014-10-02