Incidental Mutation 'R2172:Sparc'
ID237575
Institutional Source Beutler Lab
Gene Symbol Sparc
Ensembl Gene ENSMUSG00000018593
Gene Namesecreted acidic cysteine rich glycoprotein
SynonymsBM-40, osteonectin
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location55394500-55423183 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 55395801 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 324 (Q324*)
Ref Sequence ENSEMBL: ENSMUSP00000149918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018737] [ENSMUST00000108858] [ENSMUST00000141530] [ENSMUST00000213866] [ENSMUST00000214685] [ENSMUST00000216313]
Predicted Effect probably null
Transcript: ENSMUST00000018737
AA Change: Q294*
SMART Domains Protein: ENSMUSP00000018737
Gene: ENSMUSG00000018593
AA Change: Q294*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 22 42 N/A INTRINSIC
FOLN 70 93 5.24e-8 SMART
KAZAL 93 148 1.16e-9 SMART
Pfam:SPARC_Ca_bdg 151 288 5.3e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108858
AA Change: Q293*
SMART Domains Protein: ENSMUSP00000104486
Gene: ENSMUSG00000018593
AA Change: Q293*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 21 41 N/A INTRINSIC
FOLN 69 92 5.24e-8 SMART
KAZAL 92 147 1.16e-9 SMART
Pfam:SPARC_Ca_bdg 150 287 1.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130642
Predicted Effect probably benign
Transcript: ENSMUST00000141530
SMART Domains Protein: ENSMUSP00000119475
Gene: ENSMUSG00000018593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FOLN 68 91 5.24e-8 SMART
KAZAL 91 146 1.16e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213866
AA Change: Q324*
Predicted Effect probably null
Transcript: ENSMUST00000214685
AA Change: Q294*
Predicted Effect probably null
Transcript: ENSMUST00000216313
AA Change: Q324*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine-rich acidic matrix-associated protein. The encoded protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. The gene product has been associated with tumor suppression but has also been correlated with metastasis based on changes to cell shape which can promote tumor cell invasion. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cataracts, reduced skin collagen content, accelerated wound closure, osteopenia associated with reduced bone remodeling, and increased growth of implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Sparc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Sparc APN 11 55405243 missense probably damaging 0.99
IGL01790:Sparc APN 11 55407215 splice site probably null
R1711:Sparc UTSW 11 55395776 intron probably null
R1840:Sparc UTSW 11 55395866 missense probably damaging 1.00
R1859:Sparc UTSW 11 55406508 critical splice donor site probably null
R4588:Sparc UTSW 11 55405236 missense probably benign 0.00
R4860:Sparc UTSW 11 55399211 missense possibly damaging 0.92
R4860:Sparc UTSW 11 55399211 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCCTCTGCAAAGGAAGAAGG -3'
(R):5'- GCTTCCCATACTGGACTGTTG -3'

Sequencing Primer
(F):5'- GGGCGTGGTTAAAATAAGGCTCTAC -3'
(R):5'- ATACTGGACTGTTGTTCTCCCACAC -3'
Posted On2014-10-02