Incidental Mutation 'R2172:Puf60'
ID237581
Institutional Source Beutler Lab
Gene Symbol Puf60
Ensembl Gene ENSMUSG00000002524
Gene Namepoly-U binding splicing factor 60
Synonyms
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76070182-76080924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76070464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 520 (I520N)
Ref Sequence ENSEMBL: ENSMUSP00000098096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002599] [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000100527] [ENSMUST00000109946] [ENSMUST00000227316] [ENSMUST00000230924]
Predicted Effect probably damaging
Transcript: ENSMUST00000002599
AA Change: I503N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002599
Gene: ENSMUSG00000002524
AA Change: I503N

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
RRM 118 191 1.21e-22 SMART
RRM 215 288 1.6e-22 SMART
low complexity region 290 338 N/A INTRINSIC
low complexity region 400 420 N/A INTRINSIC
RRM 451 533 7.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002603
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063747
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100527
AA Change: I520N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098096
Gene: ENSMUSG00000002524
AA Change: I520N

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
RRM 135 208 1.21e-22 SMART
RRM 232 305 1.6e-22 SMART
low complexity region 307 355 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
RRM 468 550 7.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109946
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227251
Predicted Effect probably benign
Transcript: ENSMUST00000227316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229496
Predicted Effect probably benign
Transcript: ENSMUST00000230924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Puf60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02406:Puf60 APN 15 76074609 missense probably damaging 0.98
IGL02468:Puf60 APN 15 76075836 splice site probably benign
IGL03252:Puf60 APN 15 76071850 missense probably damaging 1.00
IGL03256:Puf60 APN 15 76070596 missense possibly damaging 0.47
IGL03344:Puf60 APN 15 76070380 missense possibly damaging 0.83
R0194:Puf60 UTSW 15 76070485 missense probably damaging 1.00
R0688:Puf60 UTSW 15 76070774 missense probably damaging 1.00
R1746:Puf60 UTSW 15 76070784 missense probably benign 0.08
R1770:Puf60 UTSW 15 76070874 missense probably benign 0.00
R1782:Puf60 UTSW 15 76071875 missense probably benign 0.32
R1818:Puf60 UTSW 15 76071474 missense possibly damaging 0.91
R4726:Puf60 UTSW 15 76072334 unclassified probably null
R5049:Puf60 UTSW 15 76070474 missense probably damaging 1.00
R6927:Puf60 UTSW 15 76075814 missense probably benign
R7199:Puf60 UTSW 15 76071868 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGACACACCACGGTTAAC -3'
(R):5'- GCAGTCAATTGTCTTTCCTACAGTC -3'

Sequencing Primer
(F):5'- GGACACACCACGGTTAACACTTTAC -3'
(R):5'- GTCTACAGTGATGGTTCTCCGAAAC -3'
Posted On2014-10-02