Incidental Mutation 'R2172:Sharpin'
ID237582
Institutional Source Beutler Lab
Gene Symbol Sharpin
Ensembl Gene ENSMUSG00000022552
Gene NameSHANK-associated RH domain interacting protein
SynonymsSIPL1, 0610041B22Rik, cpdm
MMRRC Submission 040174-MU
Accession Numbers

VEGA: OTTMUST00000057935; MGI: 1913331

Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R2172 (G1)
Quality Score183
Status Not validated
Chromosome15
Chromosomal Location76347040-76351111 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 76350666 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023210] [ENSMUST00000023211] [ENSMUST00000023212] [ENSMUST00000160172] [ENSMUST00000160560] [ENSMUST00000160853] [ENSMUST00000160914] [ENSMUST00000161527] [ENSMUST00000208833] [ENSMUST00000230314]
Predicted Effect probably benign
Transcript: ENSMUST00000023210
SMART Domains Protein: ENSMUSP00000023210
Gene: ENSMUSG00000022551

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Pfam:Cytochrom_C1 96 314 1.5e-100 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000023211
AA Change: A5S
SMART Domains Protein: ENSMUSP00000023211
Gene: ENSMUSG00000022552
AA Change: A5S

DomainStartEndE-ValueType
Pfam:Sharpin_PH 13 125 1.2e-44 PFAM
low complexity region 187 202 N/A INTRINSIC
PDB:4DBG|A 203 299 1e-17 PDB
SCOP:d1euvb_ 212 301 2e-5 SMART
Blast:UBQ 218 299 2e-26 BLAST
ZnF_RBZ 343 367 9.65e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023212
SMART Domains Protein: ENSMUSP00000023212
Gene: ENSMUSG00000022553

DomainStartEndE-ValueType
Pfam:Maf1 24 202 2.8e-69 PFAM
low complexity region 215 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154477
Predicted Effect probably benign
Transcript: ENSMUST00000159429
SMART Domains Protein: ENSMUSP00000124755
Gene: ENSMUSG00000022552

DomainStartEndE-ValueType
ZnF_RBZ 46 70 9.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160097
Predicted Effect probably benign
Transcript: ENSMUST00000160172
SMART Domains Protein: ENSMUSP00000124242
Gene: ENSMUSG00000022553

DomainStartEndE-ValueType
Pfam:Maf1 24 202 2.7e-70 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160560
AA Change: A5S
SMART Domains Protein: ENSMUSP00000125382
Gene: ENSMUSG00000022552
AA Change: A5S

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
PDB:4EMO|D 24 62 2e-13 PDB
low complexity region 64 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160853
SMART Domains Protein: ENSMUSP00000124893
Gene: ENSMUSG00000022553

DomainStartEndE-ValueType
Pfam:Maf1 25 202 4.6e-67 PFAM
low complexity region 215 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160875
Predicted Effect probably benign
Transcript: ENSMUST00000160914
SMART Domains Protein: ENSMUSP00000124110
Gene: ENSMUSG00000022553

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:Maf1 84 202 4.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161072
SMART Domains Protein: ENSMUSP00000125332
Gene: ENSMUSG00000022553

DomainStartEndE-ValueType
low complexity region 24 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161391
Predicted Effect probably benign
Transcript: ENSMUST00000161527
SMART Domains Protein: ENSMUSP00000125387
Gene: ENSMUSG00000022553

DomainStartEndE-ValueType
Pfam:Maf1 24 202 2.8e-69 PFAM
low complexity region 215 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162871
Predicted Effect probably benign
Transcript: ENSMUST00000208833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230016
Predicted Effect unknown
Transcript: ENSMUST00000230314
AA Change: A5S
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produces chronic skin lesions. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(2) Spontaneous(2)          

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Sharpin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sharpin APN 15 76348224 missense probably damaging 0.99
R0012:Sharpin UTSW 15 76348343 missense possibly damaging 0.88
R0012:Sharpin UTSW 15 76348343 missense possibly damaging 0.88
R1733:Sharpin UTSW 15 76347936 missense probably benign 0.00
R1735:Sharpin UTSW 15 76347936 missense probably benign 0.00
R2051:Sharpin UTSW 15 76348207 missense probably benign 0.02
R2909:Sharpin UTSW 15 76350611 unclassified probably benign
R4749:Sharpin UTSW 15 76347567 missense probably damaging 0.99
R5027:Sharpin UTSW 15 76350025 unclassified probably benign
R5050:Sharpin UTSW 15 76348330 missense probably damaging 1.00
R5062:Sharpin UTSW 15 76347611 unclassified probably benign
R5172:Sharpin UTSW 15 76347541 missense probably benign 0.02
R5428:Sharpin UTSW 15 76350666 unclassified probably benign
R5610:Sharpin UTSW 15 76350053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAACAGTCCTAGCCGGAAGC -3'
(R):5'- CTGAAAGGTGACTAGCTTGGCC -3'

Sequencing Primer
(F):5'- CGTCCAGGCCGCTCAGG -3'
(R):5'- GAGATCTGGGACCATTCCTATCG -3'
Posted On2014-10-02