Incidental Mutation 'R2173:Alpk3'
ID237618
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Namealpha-kinase 3
SynonymsMidori
MMRRC Submission 040175-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R2173 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81057600-81105612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81076900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 111 (Y111C)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
Predicted Effect probably damaging
Transcript: ENSMUST00000107348
AA Change: Y111C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: Y111C

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A C 17: 25,948,487 H25Q probably damaging Het
Alpk1 T A 3: 127,683,590 H273L probably damaging Het
Anapc2 T G 2: 25,273,276 V175G probably benign Het
Arhgap30 T C 1: 171,407,767 S570P probably damaging Het
AU040320 T C 4: 126,792,276 L215P probably benign Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Ccdc65 A G 15: 98,721,033 N298D probably benign Het
Cfap70 T A 14: 20,408,562 N727Y probably benign Het
Clcn7 A G 17: 25,145,609 H63R probably benign Het
Corin A T 5: 72,504,079 C24S probably benign Het
Cyp1a2 A G 9: 57,677,515 W419R probably damaging Het
Dlgap4 C A 2: 156,762,812 A256D probably damaging Het
Eif4enif1 A G 11: 3,242,367 probably null Het
Eri2 A G 7: 119,786,543 V245A possibly damaging Het
Erich6b T C 14: 75,658,892 F73L probably benign Het
Fam110a A G 2: 151,970,509 C114R probably damaging Het
Fam149a T C 8: 45,353,954 D288G probably damaging Het
Fam171a1 T A 2: 3,225,619 Y596* probably null Het
Fsd1 A G 17: 55,991,223 T183A possibly damaging Het
Fut10 T A 8: 31,236,131 Y305N probably damaging Het
Ganab A T 19: 8,902,260 probably benign Het
Gm9922 G T 14: 101,729,576 probably benign Het
Gp9 A G 6: 87,779,053 T17A probably benign Het
Gxylt2 T C 6: 100,798,154 Y345H probably damaging Het
Herc2 A G 7: 56,185,951 H3269R probably benign Het
Hpx A T 7: 105,592,083 S374T probably benign Het
Hspa5 T C 2: 34,774,662 V376A probably damaging Het
Hyi T C 4: 118,362,184 probably benign Het
Impdh2 G A 9: 108,565,394 probably null Het
Kremen2 A C 17: 23,742,796 W246G probably damaging Het
Krt83 A G 15: 101,487,937 V259A probably damaging Het
L3mbtl4 A T 17: 68,587,193 H398L probably damaging Het
Lama5 C A 2: 180,196,242 V894L probably benign Het
Maml2 A G 9: 13,621,616 probably benign Het
Nup153 A T 13: 46,701,600 probably benign Het
Olfr1387 G T 11: 49,460,140 V154L probably benign Het
Olfr177 A G 16: 58,872,619 F177S probably damaging Het
Olfr824 G A 10: 130,126,503 P185S probably benign Het
Olfr918 T C 9: 38,672,944 I180V probably benign Het
Olfr981 T G 9: 40,023,254 I287S probably damaging Het
Otof C T 5: 30,386,374 R582H probably damaging Het
Otud4 T C 8: 79,668,464 S543P probably damaging Het
Pde6a A G 18: 61,254,382 D448G probably damaging Het
Phgdh A G 3: 98,315,111 V388A probably benign Het
Plin3 G T 17: 56,279,891 D385E possibly damaging Het
Polg G T 7: 79,455,593 D734E probably damaging Het
Pomt1 T C 2: 32,250,900 Y515H probably damaging Het
Pwwp2a G A 11: 43,682,486 A132T probably benign Het
Rbm6 A T 9: 107,852,191 F419L possibly damaging Het
Rfx5 A G 3: 94,956,716 probably null Het
Rnf135 G A 11: 80,189,240 S119N probably benign Het
Scfd1 T A 12: 51,387,079 D51E probably benign Het
Smox A T 2: 131,512,024 E5D possibly damaging Het
Srpk2 T C 5: 23,518,615 probably null Het
Syne2 T A 12: 76,100,989 probably benign Het
Tcf20 A G 15: 82,854,692 S853P possibly damaging Het
Tmem131l A G 3: 83,926,145 F804L probably damaging Het
Ttll8 A G 15: 88,914,597 L645P probably damaging Het
Ubr3 T A 2: 69,897,399 H35Q probably benign Het
Uck1 GCCAACACC GCC 2: 32,256,076 probably benign Het
Vmn2r70 A T 7: 85,565,082 H287Q probably benign Het
Vps26a A T 10: 62,468,392 I150N probably damaging Het
Zfp605 G A 5: 110,127,457 R147H probably benign Het
Zfyve16 A G 13: 92,495,088 M1333T probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTACTTTCTGAAGCTGAGCTGAG -3'
(R):5'- TGCCCTCTAACTCCAGAGAG -3'

Sequencing Primer
(F):5'- AGTGACAGGGACAGTGCCTC -3'
(R):5'- GCGTTTCCACCCAGCTGAC -3'
Posted On2014-10-02