Incidental Mutation 'R2174:Olfr1413'
ID237662
Institutional Source Beutler Lab
Gene Symbol Olfr1413
Ensembl Gene ENSMUSG00000058904
Gene Nameolfactory receptor 1413
SynonymsGA_x6K02T2R7CC-81180849-81179878, MOR208-1
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92571322-92574397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92573657 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 162 (N162S)
Ref Sequence ENSEMBL: ENSMUSP00000150792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074859] [ENSMUST00000214239]
Predicted Effect probably benign
Transcript: ENSMUST00000074859
AA Change: N162S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074402
Gene: ENSMUSG00000058904
AA Change: N162S

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 2.3e-50 PFAM
Pfam:7tm_1 48 297 2.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185802
Predicted Effect probably benign
Transcript: ENSMUST00000214239
AA Change: N162S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Olfr1413
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Olfr1413 APN 1 92573443 missense probably benign 0.01
IGL01829:Olfr1413 APN 1 92573329 missense probably benign 0.37
IGL02160:Olfr1413 APN 1 92573357 missense probably damaging 1.00
IGL02535:Olfr1413 APN 1 92573221 missense probably benign 0.10
IGL03304:Olfr1413 APN 1 92573303 missense probably benign 0.01
R0001:Olfr1413 UTSW 1 92573461 missense possibly damaging 0.62
R0033:Olfr1413 UTSW 1 92573260 missense probably benign 0.05
R2027:Olfr1413 UTSW 1 92573767 missense probably damaging 0.99
R2152:Olfr1413 UTSW 1 92573908 missense probably damaging 1.00
R3407:Olfr1413 UTSW 1 92573953 missense probably damaging 0.99
R3408:Olfr1413 UTSW 1 92573953 missense probably damaging 0.99
R3951:Olfr1413 UTSW 1 92573789 missense possibly damaging 0.53
R4687:Olfr1413 UTSW 1 92573330 missense possibly damaging 0.63
R4793:Olfr1413 UTSW 1 92573485 missense possibly damaging 0.89
R5069:Olfr1413 UTSW 1 92573413 missense probably damaging 1.00
R5070:Olfr1413 UTSW 1 92573413 missense probably damaging 1.00
R5160:Olfr1413 UTSW 1 92573822 missense probably benign 0.02
R5411:Olfr1413 UTSW 1 92573824 missense probably benign 0.00
R7487:Olfr1413 UTSW 1 92573795 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAGGTCATCAGCTTTGCAGG -3'
(R):5'- TTGTGATGTAGCCATAGGAGATC -3'

Sequencing Primer
(F):5'- AGGATGTGCCACTCAGTTC -3'
(R):5'- TGTAGCCATAGGAGATCAGGACC -3'
Posted On2014-10-02