Incidental Mutation 'R2174:Gtf3c5'
ID237668
Institutional Source Beutler Lab
Gene Symbol Gtf3c5
Ensembl Gene ENSMUSG00000026816
Gene Namegeneral transcription factor IIIC, polypeptide 5
SynonymsTFIIICepsilon, TFIIIC63, 2700084A09Rik, TFiiiC2-63
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28566311-28583751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28567775 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 468 (D468G)
Ref Sequence ENSEMBL: ENSMUSP00000028157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028157] [ENSMUST00000028161] [ENSMUST00000113889]
Predicted Effect probably benign
Transcript: ENSMUST00000028157
AA Change: D468G

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028157
Gene: ENSMUSG00000026816
AA Change: D468G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tau95 23 322 2.8e-71 PFAM
coiled coil region 471 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028161
SMART Domains Protein: ENSMUSP00000028161
Gene: ENSMUSG00000026818

DomainStartEndE-ValueType
Pfam:COesterase 1 542 2.4e-163 PFAM
Pfam:Abhydrolase_3 121 226 8e-8 PFAM
low complexity region 568 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113889
AA Change: D474G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109521
Gene: ENSMUSG00000026816
AA Change: D474G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tau95 24 322 1.7e-85 PFAM
coiled coil region 477 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177012
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Gtf3c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Gtf3c5 APN 2 28569289 splice site probably null
R0062:Gtf3c5 UTSW 2 28572186 splice site probably benign
R0062:Gtf3c5 UTSW 2 28572186 splice site probably benign
R0395:Gtf3c5 UTSW 2 28577918 missense probably damaging 1.00
R0653:Gtf3c5 UTSW 2 28577996 missense probably benign 0.34
R1232:Gtf3c5 UTSW 2 28571215 missense probably damaging 1.00
R1828:Gtf3c5 UTSW 2 28579682 missense probably damaging 1.00
R3154:Gtf3c5 UTSW 2 28579536 missense probably damaging 0.96
R4247:Gtf3c5 UTSW 2 28571184 missense probably damaging 1.00
R4612:Gtf3c5 UTSW 2 28579584 missense probably benign 0.00
R4673:Gtf3c5 UTSW 2 28572224 missense probably benign 0.20
R5092:Gtf3c5 UTSW 2 28582873 missense possibly damaging 0.58
R6009:Gtf3c5 UTSW 2 28571165 missense probably benign 0.00
R6334:Gtf3c5 UTSW 2 28570462 missense probably benign 0.00
R6808:Gtf3c5 UTSW 2 28570487 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGGACAGCAGCTTTGGGAG -3'
(R):5'- TGGGTTCAAACATGCCTACTAGG -3'

Sequencing Primer
(F):5'- CTTTGGGAGGAGCCTCAAG -3'
(R):5'- GCTCCCTGCCTGTCCCC -3'
Posted On2014-10-02