Incidental Mutation 'R2174:Nav2'
ID237696
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49452663 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 342 (M342K)
Ref Sequence ENSEMBL: ENSMUSP00000139309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064383
SMART Domains Protein: ENSMUSP00000066835
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
Blast:CH 18 79 2e-35 BLAST
PDB:2YRN|A 18 80 3e-33 PDB
SCOP:d1dxxa1 29 81 4e-15 SMART
low complexity region 94 102 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
coiled coil region 378 408 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064395
AA Change: M403K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: M403K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183659
AA Change: M342K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: M342K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184155
Predicted Effect probably damaging
Transcript: ENSMUST00000184945
AA Change: M403K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: M403K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Antxrl T A 14: 34,060,400 L180Q probably damaging Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AAAATGTCCCTGCGCCCTTG -3'
(R):5'- GCCCTTGAGTGCAATCTTGG -3'

Sequencing Primer
(F):5'- TTGGAGAACAGCCCTTCCGTC -3'
(R):5'- AGTGCAATCTTGGGGCTGC -3'
Posted On2014-10-02