Incidental Mutation 'R2174:Antxrl'
ID237727
Institutional Source Beutler Lab
Gene Symbol Antxrl
Ensembl Gene ENSMUSG00000047441
Gene Nameanthrax toxin receptor-like
Synonyms
MMRRC Submission 040176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2174 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34052707-34076405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34060400 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 180 (L180Q)
Ref Sequence ENSEMBL: ENSMUSP00000052816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058725] [ENSMUST00000178958] [ENSMUST00000226211]
Predicted Effect probably damaging
Transcript: ENSMUST00000058725
AA Change: L180Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052816
Gene: ENSMUSG00000047441
AA Change: L180Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 74 248 2.9e-19 SMART
Pfam:Anth_Ig 249 351 6.7e-41 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 392 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Predicted Effect probably benign
Transcript: ENSMUST00000226211
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik T C 7: 38,194,828 I95T possibly damaging Het
4930452B06Rik T C 14: 8,558,109 I159V probably benign Het
Adarb1 A G 10: 77,295,798 I619T probably benign Het
Aldh2 T C 5: 121,572,668 probably benign Het
Asnsd1 A T 1: 53,347,601 I289N probably benign Het
Asxl3 T G 18: 22,453,644 S164A possibly damaging Het
Cacnb2 C T 2: 14,958,767 T108I probably benign Het
Capn2 A T 1: 182,479,725 I516N probably benign Het
Casc1 T C 6: 145,175,170 H641R probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cenpo T C 12: 4,217,318 K73R probably benign Het
Clasp1 A G 1: 118,560,095 H823R probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Ddx60 A G 8: 61,956,141 I404V probably damaging Het
Ddx60 G T 8: 62,017,200 M1407I probably benign Het
Dennd3 A T 15: 73,555,305 R844W probably damaging Het
Depdc1b A T 13: 108,362,253 K157* probably null Het
Dnajc1 T C 2: 18,307,951 D196G probably damaging Het
Fanca A G 8: 123,271,270 W1226R probably benign Het
Fbxl13 A G 5: 21,582,048 V297A possibly damaging Het
Fnta A T 8: 26,013,470 F96I possibly damaging Het
Fzd3 T C 14: 65,212,231 probably benign Het
Gckr T C 5: 31,327,009 V597A possibly damaging Het
Gm43302 T C 5: 105,274,350 K496R probably benign Het
Gm5283 A G 3: 17,230,841 noncoding transcript Het
Gm5724 A T 6: 141,727,593 Y406* probably null Het
Gm6741 A G 17: 91,236,904 I32V probably benign Het
Gnptab T A 10: 88,434,044 F870I probably damaging Het
Gpx8 G A 13: 113,045,606 P98S probably benign Het
Grm2 T C 9: 106,647,795 I574V probably benign Het
Gtf3c5 T C 2: 28,567,775 D468G probably benign Het
Hectd3 A T 4: 116,999,701 M482L probably benign Het
Ier5 G T 1: 155,098,853 P193H possibly damaging Het
Inpp4a A G 1: 37,396,130 N827S probably damaging Het
Kif13a A G 13: 46,769,176 L387P probably damaging Het
Map3k1 G C 13: 111,752,482 H1314D possibly damaging Het
Mbl2 G A 19: 30,234,012 C11Y possibly damaging Het
Msr1 A G 8: 39,631,340 L58P probably damaging Het
Mtmr10 T A 7: 64,336,764 F530Y possibly damaging Het
Myo7b A G 18: 31,983,557 L999P probably damaging Het
Myoz3 T C 18: 60,590,224 E8G probably benign Het
Naip6 C A 13: 100,298,987 M1009I probably benign Het
Nav2 T A 7: 49,452,663 M342K probably damaging Het
Ndufaf6 T C 4: 11,070,228 H131R probably benign Het
Nlrp4a T C 7: 26,449,424 L152P probably damaging Het
Olfr1413 A G 1: 92,573,657 N162S probably benign Het
Pan3 T C 5: 147,450,653 I144T possibly damaging Het
Prkdc A T 16: 15,734,922 Q2074L probably benign Het
Pthlh G A 6: 147,257,012 T150I probably benign Het
Ptprq A T 10: 107,705,553 Y371N probably damaging Het
Rfwd3 A G 8: 111,283,343 S377P probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sap130 T C 18: 31,677,479 probably null Het
Sap25 T G 5: 137,642,629 M229R possibly damaging Het
Scaper A T 9: 55,859,037 V479E probably null Het
Scn3a T A 2: 65,507,206 D649V probably damaging Het
Smc1b A G 15: 85,121,851 probably benign Het
Sowahb T C 5: 93,044,425 E145G possibly damaging Het
Stxbp5 T A 10: 9,835,846 I277F possibly damaging Het
Tanc1 T C 2: 59,843,833 S1754P possibly damaging Het
Tanc2 A G 11: 105,910,309 D1117G probably benign Het
Tbc1d31 A G 15: 57,951,741 M605V possibly damaging Het
Tekt3 A T 11: 63,094,688 D440V possibly damaging Het
Tmem67 C T 4: 12,063,730 W477* probably null Het
Tra2a T C 6: 49,250,927 probably benign Het
Trappc12 A G 12: 28,747,381 F51L possibly damaging Het
Trrap C A 5: 144,821,855 P2183Q probably benign Het
Ubn2 T A 6: 38,470,141 probably null Het
Unc5d A T 8: 28,694,540 V644E probably damaging Het
Xpo4 A G 14: 57,590,090 L883P probably damaging Het
Zbbx T G 3: 75,052,414 D616A possibly damaging Het
Zfp943 T A 17: 21,992,823 C297S probably damaging Het
Other mutations in Antxrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Antxrl APN 14 34075597 missense probably benign 0.01
IGL01632:Antxrl APN 14 34067947 missense probably damaging 0.99
IGL02379:Antxrl APN 14 34056535 splice site probably null
IGL02381:Antxrl APN 14 34056611 unclassified probably null
IGL02736:Antxrl APN 14 34056618 unclassified probably benign
R0631:Antxrl UTSW 14 34058801 critical splice donor site probably null
R1190:Antxrl UTSW 14 34069250 missense probably benign 0.00
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1454:Antxrl UTSW 14 34060949 missense probably damaging 0.99
R1469:Antxrl UTSW 14 34067431 intron probably benign
R1638:Antxrl UTSW 14 34070496 critical splice donor site probably null
R1996:Antxrl UTSW 14 34075829 missense probably benign 0.01
R2421:Antxrl UTSW 14 34071689 intron probably benign
R3850:Antxrl UTSW 14 34067381 missense probably benign 0.00
R4178:Antxrl UTSW 14 34054971 unclassified probably null
R4434:Antxrl UTSW 14 34071617 intron probably benign
R4603:Antxrl UTSW 14 34075835 missense possibly damaging 0.72
R4769:Antxrl UTSW 14 34073070 missense possibly damaging 0.53
R6003:Antxrl UTSW 14 34075635 missense possibly damaging 0.72
R6047:Antxrl UTSW 14 34053476 intron probably benign
R6228:Antxrl UTSW 14 34056599 missense probably damaging 1.00
R6363:Antxrl UTSW 14 34069287 missense probably damaging 1.00
R6525:Antxrl UTSW 14 34060406 missense probably damaging 1.00
R6800:Antxrl UTSW 14 34065907 missense probably damaging 1.00
R6933:Antxrl UTSW 14 34075771 missense possibly damaging 0.53
R7086:Antxrl UTSW 14 34065916 missense probably benign 0.26
R7257:Antxrl UTSW 14 34065849 missense probably benign 0.03
R7315:Antxrl UTSW 14 34071547 missense unknown
X0028:Antxrl UTSW 14 34053915 critical splice donor site probably null
Z1088:Antxrl UTSW 14 34067971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGAGTTCTAAACCCCTCTGG -3'
(R):5'- CACGGTGTAAACGATTGCTC -3'

Sequencing Primer
(F):5'- TGGCTCCTAATCTATAGACTAGCTAG -3'
(R):5'- GGTGTAAACGATTGCTCCCATTC -3'
Posted On2014-10-02