Incidental Mutation 'R2186:Duoxa2'
ID237747
Institutional Source Beutler Lab
Gene Symbol Duoxa2
Ensembl Gene ENSMUSG00000027225
Gene Namedual oxidase maturation factor 2
Synonyms
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122298900-122302885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122299174 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 45 (I45T)
Ref Sequence ENSEMBL: ENSMUSP00000028656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000053734] [ENSMUST00000110537] [ENSMUST00000110538]
Predicted Effect probably benign
Transcript: ENSMUST00000028653
SMART Domains Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 10 287 7.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028656
AA Change: I45T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225
AA Change: I45T

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053734
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110537
SMART Domains Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 290 3.9e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110538
SMART Domains Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 70 1.7e-23 PFAM
Pfam:DuoxA 67 245 2.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155561
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum protein that is necessary for proper cellular localization and maturation of functional dual oxidase 2. Mutations in this gene have been associated with thyroid dyshormonogenesis 5.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Duoxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Duoxa2 APN 2 122300591 missense possibly damaging 0.93
IGL02194:Duoxa2 APN 2 122301849 missense possibly damaging 0.92
R1681:Duoxa2 UTSW 2 122299162 unclassified probably null
R4062:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4064:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4757:Duoxa2 UTSW 2 122300591 missense possibly damaging 0.93
R4791:Duoxa2 UTSW 2 122301198 missense probably damaging 1.00
R5485:Duoxa2 UTSW 2 122299152 missense possibly damaging 0.82
R6025:Duoxa2 UTSW 2 122301851 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGCGCTTCTTAGGAGAGC -3'
(R):5'- TCGGAAGAGTCGCTTACTGC -3'

Sequencing Primer
(F):5'- GCAGGGCTCGGACTTTTTATCAC -3'
(R):5'- GAAGAGTCGCTTACTGCACCAG -3'
Posted On2014-10-02