Incidental Mutation 'R2186:Zfp286'
ID237780
Institutional Source Beutler Lab
Gene Symbol Zfp286
Ensembl Gene ENSMUSG00000047342
Gene Namezinc finger protein 286
Synonyms
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location62752577-62789462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62780461 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 262 (V262A)
Ref Sequence ENSEMBL: ENSMUSP00000055517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054654] [ENSMUST00000108705] [ENSMUST00000207597]
Predicted Effect probably damaging
Transcript: ENSMUST00000054654
AA Change: V262A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055517
Gene: ENSMUSG00000047342
AA Change: V262A

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
ZnF_C2H2 241 263 2.75e-3 SMART
ZnF_C2H2 269 291 2.84e-5 SMART
ZnF_C2H2 296 318 1.03e-2 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 4.24e-4 SMART
ZnF_C2H2 380 402 4.79e-3 SMART
ZnF_C2H2 408 430 1.06e-4 SMART
ZnF_C2H2 436 458 1.06e-4 SMART
ZnF_C2H2 464 486 3.95e-4 SMART
ZnF_C2H2 492 514 1.15e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082758
Predicted Effect probably benign
Transcript: ENSMUST00000108705
SMART Domains Protein: ENSMUSP00000104345
Gene: ENSMUSG00000047342

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152602
Predicted Effect probably benign
Transcript: ENSMUST00000207597
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Zfp286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02659:Zfp286 APN 11 62783737 missense possibly damaging 0.54
IGL02745:Zfp286 APN 11 62780874 missense probably damaging 1.00
IGL02826:Zfp286 APN 11 62787960 missense probably damaging 0.99
R0233:Zfp286 UTSW 11 62780393 missense possibly damaging 0.75
R0233:Zfp286 UTSW 11 62780393 missense possibly damaging 0.75
R0318:Zfp286 UTSW 11 62784962 missense probably damaging 1.00
R1954:Zfp286 UTSW 11 62783708 missense possibly damaging 0.46
R1994:Zfp286 UTSW 11 62779820 missense probably damaging 1.00
R4258:Zfp286 UTSW 11 62781070 missense probably benign 0.07
R4327:Zfp286 UTSW 11 62780018 missense probably damaging 1.00
R4453:Zfp286 UTSW 11 62780204 missense probably damaging 1.00
R4479:Zfp286 UTSW 11 62780204 missense probably damaging 1.00
R4647:Zfp286 UTSW 11 62783733 nonsense probably null
R4667:Zfp286 UTSW 11 62780602 missense probably benign 0.00
R4883:Zfp286 UTSW 11 62780629 missense probably benign 0.01
R4978:Zfp286 UTSW 11 62788928 critical splice donor site probably null
R5120:Zfp286 UTSW 11 62780725 missense probably benign 0.40
R5533:Zfp286 UTSW 11 62780970 intron probably benign
R7236:Zfp286 UTSW 11 62783670 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGTAAGAGATGAGCAGTGGC -3'
(R):5'- TGATGACAGAGACCCCAAAGGA -3'

Sequencing Primer
(F):5'- TTCACCCCAGTATGAATCAGCTGATG -3'
(R):5'- CAAAGGATCCTGGGACGTTCAC -3'
Posted On2014-10-02