Incidental Mutation 'R2186:Asgr1'
ID237781
Institutional Source Beutler Lab
Gene Symbol Asgr1
Ensembl Gene ENSMUSG00000020884
Gene Nameasialoglycoprotein receptor 1
SynonymsAsgr-1, Asgr, ASGPR1
MMRRC Submission 040188-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2186 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70054085-70057894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70056249 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 66 (R66Q)
Ref Sequence ENSEMBL: ENSMUSP00000104226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018699] [ENSMUST00000092959] [ENSMUST00000108585] [ENSMUST00000123369] [ENSMUST00000146411]
Predicted Effect probably benign
Transcript: ENSMUST00000018699
AA Change: R66Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000018699
Gene: ENSMUSG00000020884
AA Change: R66Q

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092959
AA Change: R66Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090637
Gene: ENSMUSG00000020884
AA Change: R66Q

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108585
AA Change: R66Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104226
Gene: ENSMUSG00000020884
AA Change: R66Q

DomainStartEndE-ValueType
Blast:GuKc 1 112 1e-24 BLAST
CLECT 124 248 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123369
SMART Domains Protein: ENSMUSP00000137469
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 1 43 2e-19 PFAM
CLECT 53 129 9.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146411
AA Change: R66Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121842
Gene: ENSMUSG00000020884
AA Change: R66Q

DomainStartEndE-ValueType
Pfam:Lectin_N 13 143 4.7e-55 PFAM
CLECT 153 277 2.23e-40 SMART
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired hepatic clearance of asialoglycoproteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Camk4 A C 18: 33,182,341 D307A probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Asgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02651:Asgr1 APN 11 70057130 missense possibly damaging 0.65
R1371:Asgr1 UTSW 11 70056097 missense probably benign 0.04
R1471:Asgr1 UTSW 11 70056093 missense possibly damaging 0.82
R1980:Asgr1 UTSW 11 70054946 missense probably damaging 1.00
R5757:Asgr1 UTSW 11 70054952 missense probably benign 0.01
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6478:Asgr1 UTSW 11 70056894 missense possibly damaging 0.94
R6963:Asgr1 UTSW 11 70055968 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATACGCTCTCTTGCAGGG -3'
(R):5'- TCCCACACTACTTCCTAGAGG -3'

Sequencing Primer
(F):5'- AGCGACTCTGCTCTGGATC -3'
(R):5'- ACACTACTTCCTAGAGGATAAACTTG -3'
Posted On2014-10-02