Incidental Mutation 'R2186:Camk4'
ID237793
Institutional Source Beutler Lab
Gene Symbol Camk4
Ensembl Gene ENSMUSG00000038128
Gene Namecalcium/calmodulin-dependent protein kinase IV
SynonymsD18Bwg0362e, CaMKIV/Gr, CaMKIV, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik
MMRRC Submission 040188-MU
Accession Numbers

Genbank: NM_009793; MGI: 88258

Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2186 (G1)
Quality Score217
Status Validated
Chromosome18
Chromosomal Location32939041-33195767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33182341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 307 (D307A)
Ref Sequence ENSEMBL: ENSMUSP00000046539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042868]
Predicted Effect probably damaging
Transcript: ENSMUST00000042868
AA Change: D307A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046539
Gene: ENSMUSG00000038128
AA Change: D307A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
S_TKc 42 296 8.7e-106 SMART
low complexity region 318 344 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for different targeted mutations show variable phenotypes, including reduced viability, male and/or female sterility, and mild to severe neurological and spatial memory disorders. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(3) Targeted, other(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,514 N29S probably damaging Het
4931409K22Rik C T 5: 24,554,526 G82E probably damaging Het
Ap1b1 T C 11: 5,015,737 V92A possibly damaging Het
Asgr1 G A 11: 70,056,249 R66Q probably benign Het
Atp8b4 T A 2: 126,358,860 Q796L probably damaging Het
Catsperb T A 12: 101,480,782 I223K probably benign Het
Ccdc80 A G 16: 45,118,105 Y725C probably damaging Het
Cep164 T A 9: 45,768,578 Q1119L probably damaging Het
Cep85l G A 10: 53,348,618 P292S probably damaging Het
Cfap53 A G 18: 74,329,505 probably null Het
Cts8 C A 13: 61,251,731 C138F probably damaging Het
Dis3l C A 9: 64,339,612 E54* probably null Het
Dnaja1 T A 4: 40,732,853 D367E probably benign Het
Duoxa2 T C 2: 122,299,174 I45T probably damaging Het
EU599041 C T 7: 43,225,909 noncoding transcript Het
Exoc5 T C 14: 49,015,479 M561V probably benign Het
Fam184a T C 10: 53,638,194 I296V probably damaging Het
Fbxl18 C T 5: 142,878,761 V686M probably damaging Het
Fryl A G 5: 73,064,975 S2088P probably damaging Het
Fus G A 7: 127,985,534 probably benign Het
Gm38394 A G 1: 133,658,079 S507P probably damaging Het
Gpr183 T A 14: 121,954,315 I265L probably benign Het
Herc1 T G 9: 66,439,901 L2013V probably benign Het
Ick C T 9: 78,131,487 T6M probably benign Het
Iqca T C 1: 90,081,344 K430R probably benign Het
Itpripl2 A G 7: 118,491,277 C20R probably damaging Het
Kmt2c C A 5: 25,287,112 C852F probably damaging Het
Lamb1 A T 12: 31,318,467 K1199* probably null Het
Lrba A G 3: 86,304,336 Y421C probably damaging Het
Lrig2 A G 3: 104,468,598 L96P probably benign Het
Mcc A G 18: 44,812,078 F29S possibly damaging Het
Mlh1 T C 9: 111,258,566 probably benign Het
Mpp5 T C 12: 78,819,371 probably benign Het
Rbm33 A G 5: 28,394,230 T867A unknown Het
Sdk1 T A 5: 142,046,292 S1041T probably benign Het
Serpinb2 A G 1: 107,523,964 probably null Het
Serpinb9d A G 13: 33,203,047 N366S possibly damaging Het
Sf3b1 A G 1: 55,007,633 S251P probably benign Het
Slc45a1 T C 4: 150,638,251 Y392C probably benign Het
Tlr4 T A 4: 66,839,983 C338S possibly damaging Het
Trio A G 15: 27,823,975 probably null Het
Vnn1 A T 10: 23,897,401 I109L probably benign Het
Wnk1 A G 6: 119,948,567 V1312A probably benign Het
Zfp28 A G 7: 6,394,498 H644R probably damaging Het
Zfp286 A G 11: 62,780,461 V262A probably damaging Het
Zfp292 A T 4: 34,807,962 M1694K probably benign Het
Other mutations in Camk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
7510:Camk4 UTSW 18 33156839 missense probably null 0.99
R0244:Camk4 UTSW 18 33179625 critical splice donor site probably null
R0408:Camk4 UTSW 18 33129792 missense probably damaging 1.00
R0744:Camk4 UTSW 18 32939454 missense unknown
R0836:Camk4 UTSW 18 32939454 missense unknown
R0903:Camk4 UTSW 18 33182330 missense probably benign 0.08
R1449:Camk4 UTSW 18 32939475 missense probably damaging 0.99
R1456:Camk4 UTSW 18 33129843 splice site probably benign
R1677:Camk4 UTSW 18 33176222 missense probably damaging 1.00
R1733:Camk4 UTSW 18 33078021 missense possibly damaging 0.54
R1909:Camk4 UTSW 18 33158816 splice site probably null
R2291:Camk4 UTSW 18 33107943 critical splice donor site probably null
R3874:Camk4 UTSW 18 33158854 missense possibly damaging 0.70
R3968:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3969:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3970:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R4858:Camk4 UTSW 18 33176213 missense probably damaging 0.98
R5251:Camk4 UTSW 18 33184879 missense probably benign 0.31
R5343:Camk4 UTSW 18 33078069 missense probably damaging 0.99
R5972:Camk4 UTSW 18 33107926 missense probably damaging 1.00
R6155:Camk4 UTSW 18 32939447 missense unknown
R6728:Camk4 UTSW 18 33184939 missense probably benign
R7088:Camk4 UTSW 18 32939531 missense probably benign 0.02
R7135:Camk4 UTSW 18 33107943 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCCTACTCCTGAGGGTGT -3'
(R):5'- AGTGTTTCCCTTGTTAAGAGAGA -3'

Sequencing Primer
(F):5'- TGCTAGTGATAACGGAGTAGCC -3'
(R):5'- CACCTAAGTGGCTTTATGTCAGTAC -3'
Posted On2014-10-02