Incidental Mutation 'R0178:Fer1l6'
ID23781
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0178 (G1)
Quality Score212
Status Validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 58637914 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159705
Predicted Effect probably null
Transcript: ENSMUST00000161028
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.6364 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGTTTTATGTGACCAACTGCCC -3'
(R):5'- TCATTGGCCCTCAAGAGCATGAAC -3'

Sequencing Primer
(F):5'- GAAAGGGCGAATCATTGTCTATTG -3'
(R):5'- GGAGACAACTTACATCTCATACTGG -3'
Posted On2013-04-16