Incidental Mutation 'R2185:Eml2'
ID237820
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19194028 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 254 (Y254C)
Ref Sequence ENSEMBL: ENSMUSP00000112447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
Predicted Effect probably damaging
Transcript: ENSMUST00000048502
AA Change: Y273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: Y273C

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117338
AA Change: Y446C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: Y446C

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120595
AA Change: Y254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: Y254C

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148246
AA Change: Y254C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811
AA Change: Y254C

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Ncbp2 A G 16: 31,956,377 D116G probably damaging Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGAGGTTTGTCCCAGGTG -3'
(R):5'- CATGGATTCCACCTGAGCATGG -3'

Sequencing Primer
(F):5'- AGGTGGCCTGAGTCTTTTAGGAG -3'
(R):5'- GATTCCACCTGAGCATGGTTACAG -3'
Posted On2014-10-02