Incidental Mutation 'R2185:Ncbp2'
ID237845
Institutional Source Beutler Lab
Gene Symbol Ncbp2
Ensembl Gene ENSMUSG00000022774
Gene Namenuclear cap binding protein subunit 2
Synonyms20kDa
MMRRC Submission 040187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2185 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location31948513-31961781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31956377 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 116 (D116G)
Ref Sequence ENSEMBL: ENSMUSP00000156386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000231360]
Predicted Effect probably damaging
Transcript: ENSMUST00000023460
AA Change: D116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774
AA Change: D116G

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126215
AA Change: D116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000231360
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,567 D119G probably damaging Het
Abca1 A G 4: 53,089,830 M427T probably benign Het
Ankra2 T C 13: 98,266,404 F53S probably damaging Het
Ano3 T C 2: 110,775,045 E272G probably benign Het
Aqr C T 2: 114,130,534 probably null Het
Clca4b T C 3: 144,928,556 Y92C probably damaging Het
Crebbp A T 16: 4,084,138 N2374K probably damaging Het
Cspg4 A T 9: 56,886,972 I664L probably benign Het
Ctnnd1 A T 2: 84,612,548 D626E probably damaging Het
Eml2 A G 7: 19,194,028 Y254C probably damaging Het
Fam92a A T 4: 12,169,041 probably benign Het
Gabrr3 T C 16: 59,434,668 S239P probably damaging Het
Gen1 T C 12: 11,261,040 T64A probably null Het
Gm14399 C A 2: 175,131,395 C189F probably damaging Het
Gm8251 G A 1: 44,061,381 H186Y probably benign Het
Gm9476 T G 10: 100,307,178 noncoding transcript Het
Kcnh5 A T 12: 75,130,931 F134I possibly damaging Het
Kdm4b G C 17: 56,393,750 A474P probably benign Het
Kif2b TTCTCTCTCT TTCTCTCT 11: 91,576,971 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc28 C T 7: 67,545,453 R203Q possibly damaging Het
Lrrc8e G T 8: 4,234,986 E404* probably null Het
Macf1 A T 4: 123,475,556 M239K probably damaging Het
Mamdc4 A G 2: 25,569,692 probably null Het
Matr3 A G 18: 35,581,225 Y75C probably damaging Het
Myo19 T C 11: 84,892,221 V187A probably benign Het
Olfr1012 T C 2: 85,760,019 Y119C probably damaging Het
Olfr1208 A C 2: 88,896,703 V298G probably damaging Het
Olfr412 A T 11: 74,364,746 I26F probably benign Het
Olfr679 T A 7: 105,086,302 D195E possibly damaging Het
Pkd1l3 T A 8: 109,633,195 M894K possibly damaging Het
Prpf8 C T 11: 75,487,113 R8* probably null Het
Prss12 T A 3: 123,487,144 S493T probably benign Het
Ptov1 T G 7: 44,867,283 probably benign Het
Rfpl4 A T 7: 5,115,500 L24M probably damaging Het
Rundc1 C A 11: 101,425,331 D76E probably benign Het
Slc5a11 G T 7: 123,273,198 A673S probably damaging Het
Smg5 T C 3: 88,351,561 M613T probably benign Het
Swt1 T A 1: 151,384,468 H677L probably damaging Het
Tas2r107 T C 6: 131,659,603 N161S probably damaging Het
Trp73 A T 4: 154,104,817 probably null Het
Tsr1 A G 11: 74,902,080 I405V probably damaging Het
Ttll4 A G 1: 74,679,829 T280A possibly damaging Het
Ube2q2 A G 9: 55,195,082 probably null Het
Usp5 T C 6: 124,817,410 E769G probably damaging Het
Vmn2r68 T A 7: 85,233,693 K284* probably null Het
Wdr63 A G 3: 146,066,864 S476P possibly damaging Het
Zfp963 C A 8: 69,742,911 K297N probably benign Het
Zfp975 C A 7: 42,661,681 A503S possibly damaging Het
Other mutations in Ncbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Ncbp2 APN 16 31954153 missense probably damaging 1.00
R1929:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2270:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2271:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2272:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R6405:Ncbp2 UTSW 16 31956343 frame shift probably null
R6406:Ncbp2 UTSW 16 31956341 frame shift probably null
R6406:Ncbp2 UTSW 16 31956343 frame shift probably null
R6444:Ncbp2 UTSW 16 31956343 frame shift probably null
R6446:Ncbp2 UTSW 16 31956343 frame shift probably null
R6448:Ncbp2 UTSW 16 31956343 frame shift probably null
R6530:Ncbp2 UTSW 16 31956343 frame shift probably null
R6531:Ncbp2 UTSW 16 31956343 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCCCAGAAGTCGTGTTAGAC -3'
(R):5'- GAGGCCCCTACCATGAGTTTAG -3'

Sequencing Primer
(F):5'- CCAGAAGTCGTGTTAGACCAACTTTG -3'
(R):5'- CCTGGCAAGATCTTATCTCAGGAAG -3'
Posted On2014-10-02