Incidental Mutation 'R2188:Trim27'
ID 237939
Institutional Source Beutler Lab
Gene Symbol Trim27
Ensembl Gene ENSMUSG00000021326
Gene Name tripartite motif-containing 27
Synonyms Rfp
MMRRC Submission 040190-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.369) question?
Stock # R2188 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 21363615-21378894 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21367987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 201 (L201S)
Ref Sequence ENSEMBL: ENSMUSP00000152179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021761] [ENSMUST00000221464] [ENSMUST00000222544] [ENSMUST00000223065]
AlphaFold Q62158
Predicted Effect probably damaging
Transcript: ENSMUST00000021761
AA Change: L201S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021761
Gene: ENSMUSG00000021326
AA Change: L201S

DomainStartEndE-ValueType
RING 16 56 2.53e-6 SMART
BBOX 91 132 4.71e-15 SMART
low complexity region 146 170 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
PRY 315 367 7.09e-28 SMART
SPRY 368 493 1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220690
Predicted Effect probably damaging
Transcript: ENSMUST00000221464
AA Change: L25S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000222544
AA Change: L201S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223065
AA Change: L201S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit exhibit increased potassium/calcium channel activity and TCR-stimulated calcium influx in Th1 and Th2 CD4 T cells. Mice homozygous for another gene trap allele exhibit decreased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,838,367 (GRCm39) L547P probably damaging Het
Arhgap29 A C 3: 121,784,658 (GRCm39) D195A probably damaging Het
Atad3a A T 4: 155,835,976 (GRCm39) I274N probably damaging Het
Ccdc12 G T 9: 110,485,699 (GRCm39) K23N possibly damaging Het
Ccpg1 A G 9: 72,920,388 (GRCm39) T668A probably benign Het
Cdc34b T C 11: 94,632,998 (GRCm39) I66T probably benign Het
Dnah1 A G 14: 31,001,121 (GRCm39) I2408T probably damaging Het
Fam91a1 A C 15: 58,302,512 (GRCm39) N284T probably damaging Het
Gbp2b A T 3: 142,314,040 (GRCm39) E440V probably benign Het
Gm5134 T C 10: 75,831,670 (GRCm39) S370P probably damaging Het
Hmcn2 G A 2: 31,309,947 (GRCm39) A3238T probably benign Het
Hmg20a A G 9: 56,384,584 (GRCm39) E118G possibly damaging Het
Itprid2 T C 2: 79,475,267 (GRCm39) S409P probably benign Het
Kdm5a T A 6: 120,383,601 (GRCm39) F781I possibly damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kmt2d A G 15: 98,737,181 (GRCm39) probably benign Het
Lrp1b T C 2: 41,298,971 (GRCm39) T857A probably benign Het
Mucl2 T A 15: 103,927,840 (GRCm39) N39I probably damaging Het
Myl6 A G 10: 128,328,566 (GRCm39) I27T possibly damaging Het
Ndor1 A T 2: 25,141,765 (GRCm39) probably null Het
Nlrp9a A G 7: 26,264,354 (GRCm39) E758G probably damaging Het
Or52h7 G A 7: 104,213,883 (GRCm39) A152T probably benign Het
Or8u8 A T 2: 86,011,780 (GRCm39) I225N probably damaging Het
Parp3 G A 9: 106,353,051 (GRCm39) R42W probably damaging Het
Pik3c2g A G 6: 139,798,600 (GRCm39) I495V probably damaging Het
Qrfprl C A 6: 65,418,260 (GRCm39) H143N probably damaging Het
Sdsl C T 5: 120,596,485 (GRCm39) G310S probably damaging Het
Sec24a A G 11: 51,614,411 (GRCm39) L531P probably damaging Het
Slc2a12 C T 10: 22,540,736 (GRCm39) S197F probably benign Het
Snapc1 T A 12: 74,017,001 (GRCm39) I213N probably damaging Het
Srpk1 A T 17: 28,813,163 (GRCm39) I527N probably damaging Het
Steap2 G T 5: 5,723,643 (GRCm39) Y412* probably null Het
Tbk1 A C 10: 121,399,836 (GRCm39) Y329* probably null Het
Tekt5 T C 16: 10,176,189 (GRCm39) E452G probably damaging Het
Tmc5 G T 7: 118,254,178 (GRCm39) C672F probably damaging Het
Vil1 A C 1: 74,466,724 (GRCm39) D638A probably benign Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Zfp583 C T 7: 6,320,610 (GRCm39) R134H probably benign Het
Other mutations in Trim27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Trim27 APN 13 21,376,662 (GRCm39) missense probably damaging 0.98
IGL02756:Trim27 APN 13 21,374,256 (GRCm39) splice site probably benign
IGL03199:Trim27 APN 13 21,375,421 (GRCm39) splice site probably null
R0016:Trim27 UTSW 13 21,375,399 (GRCm39) missense probably benign 0.14
R0016:Trim27 UTSW 13 21,375,399 (GRCm39) missense probably benign 0.14
R1709:Trim27 UTSW 13 21,372,235 (GRCm39) critical splice donor site probably null
R4472:Trim27 UTSW 13 21,374,056 (GRCm39) missense probably benign 0.00
R4657:Trim27 UTSW 13 21,367,930 (GRCm39) missense probably damaging 1.00
R4677:Trim27 UTSW 13 21,365,086 (GRCm39) critical splice donor site probably null
R5019:Trim27 UTSW 13 21,374,134 (GRCm39) missense probably damaging 1.00
R5584:Trim27 UTSW 13 21,376,719 (GRCm39) missense probably damaging 1.00
R6226:Trim27 UTSW 13 21,365,086 (GRCm39) critical splice donor site probably benign
R6774:Trim27 UTSW 13 21,376,624 (GRCm39) missense probably damaging 1.00
R7378:Trim27 UTSW 13 21,376,631 (GRCm39) missense possibly damaging 0.92
R7573:Trim27 UTSW 13 21,364,770 (GRCm39) missense probably damaging 0.96
R7662:Trim27 UTSW 13 21,376,328 (GRCm39) missense probably benign 0.05
R8272:Trim27 UTSW 13 21,364,780 (GRCm39) missense probably benign 0.14
R8723:Trim27 UTSW 13 21,374,807 (GRCm39) intron probably benign
R8914:Trim27 UTSW 13 21,364,993 (GRCm39) missense possibly damaging 0.77
R9380:Trim27 UTSW 13 21,364,680 (GRCm39) missense probably benign 0.00
R9717:Trim27 UTSW 13 21,374,296 (GRCm39) critical splice donor site probably null
X0062:Trim27 UTSW 13 21,368,044 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGACCGGGTCCCTTAAGATC -3'
(R):5'- GGTAAAAGCTGCTGTCCTGC -3'

Sequencing Primer
(F):5'- TCTGGTGTGTAAAGACTGGAAAGTG -3'
(R):5'- CAGTGCTCTCTTGGTTACCTGTAAG -3'
Posted On 2014-10-02