Incidental Mutation 'R2189:Cry2'
ID237956
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Namecryptochrome 2 (photolyase-like)
Synonyms
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location92403646-92434043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92411692 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 572 (E572G)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090559
AA Change: E572G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: E572G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111278
AA Change: E572G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: E572G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126002
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACCACTGCAAAGGTTTACAGG -3'
(R):5'- AGGTCACTGCTGCAAAGGAG -3'

Sequencing Primer
(F):5'- GGGCTGCATATCAGATCTCCTG -3'
(R):5'- CTGCTGCAAAGGAGGCCAG -3'
Posted On2014-10-02