Incidental Mutation 'R0180:Dnm1'
ID23798
Institutional Source Beutler Lab
Gene Symbol Dnm1
Ensembl Gene ENSMUSG00000026825
Gene Namedynamin 1
Synonymsdynamin 1, Ftfl
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0180 (G1)
Quality Score224
Status Validated (trace)
Chromosome2
Chromosomal Location32308471-32353338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32327993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 464 (I464L)
Ref Sequence ENSEMBL: ENSMUSP00000143955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000091089] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably damaging
Transcript: ENSMUST00000078352
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091089
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113350
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113352
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113365
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139624
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201433
AA Change: I464L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201494
AA Change: I435L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825
AA Change: I435L

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202578
AA Change: I464L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825
AA Change: I464L

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein is a GTPase which is required for membrane recycling, including vesicle endocytosis in neurons. It may also be involved in cellular fission via association with microtubules and actin filaments. Mutations in this gene have been shown to cause seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice display reduced postnatal viability. Null mutation of this gene results in abnormal synaptic vesicle morphology, and recycling during neuronal activity. Other alleles are associated with seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Dnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Dnm1 APN 2 32323450 missense probably benign 0.18
IGL02338:Dnm1 APN 2 32312771 missense probably damaging 1.00
IGL02555:Dnm1 APN 2 32328038 missense probably damaging 1.00
IGL02563:Dnm1 APN 2 32315919 splice site probably null
IGL03006:Dnm1 APN 2 32353121 missense possibly damaging 0.84
IGL03013:Dnm1 APN 2 32336284 missense probably benign 0.13
IGL03347:Dnm1 APN 2 32353187 missense probably benign 0.32
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0387:Dnm1 UTSW 2 32320581 missense possibly damaging 0.90
R0608:Dnm1 UTSW 2 32335824 missense possibly damaging 0.89
R1230:Dnm1 UTSW 2 32315909 missense probably damaging 1.00
R1474:Dnm1 UTSW 2 32320584 missense probably benign 0.31
R1703:Dnm1 UTSW 2 32323451 missense probably benign 0.01
R1881:Dnm1 UTSW 2 32323730 missense probably damaging 1.00
R2155:Dnm1 UTSW 2 32314937 missense probably damaging 0.96
R4405:Dnm1 UTSW 2 32335972 missense probably damaging 1.00
R4592:Dnm1 UTSW 2 32336011 missense probably damaging 0.99
R5357:Dnm1 UTSW 2 32336241 missense probably null 0.17
R5926:Dnm1 UTSW 2 32315804 missense probably benign 0.00
R6135:Dnm1 UTSW 2 32333063 splice site probably null
R6463:Dnm1 UTSW 2 32309591 utr 3 prime probably benign
R6563:Dnm1 UTSW 2 32312726 missense probably damaging 1.00
R6626:Dnm1 UTSW 2 32340880 missense probably damaging 1.00
R6707:Dnm1 UTSW 2 32336241 missense probably null 0.17
R6790:Dnm1 UTSW 2 32333067 missense probably damaging 1.00
R6803:Dnm1 UTSW 2 32312754 missense probably damaging 1.00
R7156:Dnm1 UTSW 2 32340467 missense probably damaging 1.00
R7313:Dnm1 UTSW 2 32336009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- gtaaaaaCATGGTAGGTGGCatcaccata -3'
(R):5'- GGAGACTGCCTCTTGCCCAATGAAA -3'

Sequencing Primer
(F):5'- gtgggtggtggcgatgg -3'
(R):5'- CTGGGAAGACCCTTGAACTG -3'
Posted On2013-04-16