Incidental Mutation 'R2190:Ccdc129'
ID238024
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 040192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R2190 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55897700 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 212 (T212A)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044729
AA Change: T212A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: T212A

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,040,153 T56S probably damaging Het
Acbd6 A T 1: 155,624,906 H204L probably damaging Het
Acnat2 T A 4: 49,383,551 M1L probably benign Het
Adgrg5 A T 8: 94,933,951 I73F probably damaging Het
Ankrd52 A G 10: 128,383,618 T474A probably benign Het
Arid3a A G 10: 79,946,531 D252G possibly damaging Het
Aspg G T 12: 112,124,888 E501D probably damaging Het
Bicral A G 17: 46,825,123 I387T probably damaging Het
Bub1 T C 2: 127,810,725 N574S probably benign Het
Casr G A 16: 36,495,416 T764M probably damaging Het
Ccdc60 A G 5: 116,157,580 S259P probably damaging Het
Ccne2 A T 4: 11,197,241 N181I probably benign Het
Chd4 A G 6: 125,114,297 D89G probably benign Het
Col25a1 C T 3: 130,584,715 P606S probably damaging Het
Dcc A G 18: 71,547,420 S582P possibly damaging Het
Dlg4 A G 11: 70,042,604 D619G probably damaging Het
Elavl2 C T 4: 91,264,094 V129I probably benign Het
Epha3 A G 16: 63,546,189 I965T probably benign Het
Fbxw16 G A 9: 109,436,671 S360L probably damaging Het
Fgf14 T C 14: 123,983,918 Y158C probably damaging Het
Gm44511 A G 6: 128,826,200 I16T possibly damaging Het
Has2 C A 15: 56,667,787 V511F probably benign Het
Heatr5b G A 17: 78,801,756 R1025C probably damaging Het
Hsd17b12 T C 2: 94,034,063 Y233C probably benign Het
Il1f5 A T 2: 24,280,819 I43F probably damaging Het
Inpp5b T A 4: 124,785,195 I465N probably damaging Het
Irak2 T A 6: 113,686,943 N423K probably damaging Het
Itga2 C A 13: 114,870,605 V396L probably benign Het
Lipo2 A T 19: 33,748,569 N94K probably damaging Het
Lrrc37a T C 11: 103,500,043 T1519A possibly damaging Het
Macf1 A G 4: 123,459,212 V1558A probably benign Het
Mocos C A 18: 24,664,057 H91Q probably benign Het
Myh14 G A 7: 44,661,063 T132I probably damaging Het
Nlrp2 A T 7: 5,319,238 D803E possibly damaging Het
Ntsr2 T A 12: 16,654,017 I173N probably damaging Het
Olfr1458 T G 19: 13,102,493 K270N probably damaging Het
Olfr299 A G 7: 86,466,365 Y318C possibly damaging Het
Pitx3 T C 19: 46,137,047 Y86C probably damaging Het
Pkp1 T C 1: 135,879,971 S520G probably benign Het
Pygo1 C T 9: 72,945,247 Q239* probably null Het
Rab13 A G 3: 90,223,544 E68G probably damaging Het
Rfx7 A G 9: 72,617,919 E797G probably benign Het
Slc5a1 T C 5: 33,104,593 probably null Het
Slco1c1 A G 6: 141,563,167 T518A probably benign Het
Spint1 A G 2: 119,238,180 I132V probably benign Het
Stard9 T A 2: 120,714,120 I4514N probably benign Het
Tenm3 T G 8: 48,395,544 S87R probably damaging Het
Thap4 G T 1: 93,750,659 P135Q probably damaging Het
Tmed9 A G 13: 55,593,343 E57G probably benign Het
Tnrc18 C T 5: 142,775,889 V594I unknown Het
Trmt1 A T 8: 84,689,841 K64* probably null Het
Usf2 A G 7: 30,955,181 V198A probably damaging Het
Usp14 A T 18: 10,007,835 C168S probably damaging Het
Vav3 C A 3: 109,562,814 T525K probably damaging Het
Vmn1r52 A G 6: 90,179,169 I152V probably benign Het
Vmn2r81 A G 10: 79,268,251 D236G possibly damaging Het
Wdr19 G A 5: 65,244,166 V975I possibly damaging Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1936:Ccdc129 UTSW 6 55897681 missense probably damaging 1.00
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTTCATCAACTTGGAAAAGC -3'
(R):5'- TGGGTTACCATCCATCCTGC -3'

Sequencing Primer
(F):5'- GTGTACATTCCACACACGTG -3'
(R):5'- TGCTCGTCTGTCTTGAAGC -3'
Posted On2014-10-02