Incidental Mutation 'R2190:Nlrp2'
ID238031
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 040192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2190 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5319238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 803 (D803E)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045022
AA Change: D803E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: D803E

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207520
AA Change: D65E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,040,153 T56S probably damaging Het
Acbd6 A T 1: 155,624,906 H204L probably damaging Het
Acnat2 T A 4: 49,383,551 M1L probably benign Het
Adgrg5 A T 8: 94,933,951 I73F probably damaging Het
Ankrd52 A G 10: 128,383,618 T474A probably benign Het
Arid3a A G 10: 79,946,531 D252G possibly damaging Het
Aspg G T 12: 112,124,888 E501D probably damaging Het
Bicral A G 17: 46,825,123 I387T probably damaging Het
Bub1 T C 2: 127,810,725 N574S probably benign Het
Casr G A 16: 36,495,416 T764M probably damaging Het
Ccdc129 A G 6: 55,897,700 T212A possibly damaging Het
Ccdc60 A G 5: 116,157,580 S259P probably damaging Het
Ccne2 A T 4: 11,197,241 N181I probably benign Het
Chd4 A G 6: 125,114,297 D89G probably benign Het
Col25a1 C T 3: 130,584,715 P606S probably damaging Het
Dcc A G 18: 71,547,420 S582P possibly damaging Het
Dlg4 A G 11: 70,042,604 D619G probably damaging Het
Elavl2 C T 4: 91,264,094 V129I probably benign Het
Epha3 A G 16: 63,546,189 I965T probably benign Het
Fbxw16 G A 9: 109,436,671 S360L probably damaging Het
Fgf14 T C 14: 123,983,918 Y158C probably damaging Het
Gm44511 A G 6: 128,826,200 I16T possibly damaging Het
Has2 C A 15: 56,667,787 V511F probably benign Het
Heatr5b G A 17: 78,801,756 R1025C probably damaging Het
Hsd17b12 T C 2: 94,034,063 Y233C probably benign Het
Il1f5 A T 2: 24,280,819 I43F probably damaging Het
Inpp5b T A 4: 124,785,195 I465N probably damaging Het
Irak2 T A 6: 113,686,943 N423K probably damaging Het
Itga2 C A 13: 114,870,605 V396L probably benign Het
Lipo2 A T 19: 33,748,569 N94K probably damaging Het
Lrrc37a T C 11: 103,500,043 T1519A possibly damaging Het
Macf1 A G 4: 123,459,212 V1558A probably benign Het
Mocos C A 18: 24,664,057 H91Q probably benign Het
Myh14 G A 7: 44,661,063 T132I probably damaging Het
Ntsr2 T A 12: 16,654,017 I173N probably damaging Het
Olfr1458 T G 19: 13,102,493 K270N probably damaging Het
Olfr299 A G 7: 86,466,365 Y318C possibly damaging Het
Pitx3 T C 19: 46,137,047 Y86C probably damaging Het
Pkp1 T C 1: 135,879,971 S520G probably benign Het
Pygo1 C T 9: 72,945,247 Q239* probably null Het
Rab13 A G 3: 90,223,544 E68G probably damaging Het
Rfx7 A G 9: 72,617,919 E797G probably benign Het
Slc5a1 T C 5: 33,104,593 probably null Het
Slco1c1 A G 6: 141,563,167 T518A probably benign Het
Spint1 A G 2: 119,238,180 I132V probably benign Het
Stard9 T A 2: 120,714,120 I4514N probably benign Het
Tenm3 T G 8: 48,395,544 S87R probably damaging Het
Thap4 G T 1: 93,750,659 P135Q probably damaging Het
Tmed9 A G 13: 55,593,343 E57G probably benign Het
Tnrc18 C T 5: 142,775,889 V594I unknown Het
Trmt1 A T 8: 84,689,841 K64* probably null Het
Usf2 A G 7: 30,955,181 V198A probably damaging Het
Usp14 A T 18: 10,007,835 C168S probably damaging Het
Vav3 C A 3: 109,562,814 T525K probably damaging Het
Vmn1r52 A G 6: 90,179,169 I152V probably benign Het
Vmn2r81 A G 10: 79,268,251 D236G possibly damaging Het
Wdr19 G A 5: 65,244,166 V975I possibly damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 unclassified probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGTGTAAGTGTGAAGGCAAC -3'
(R):5'- ACCCTTCAATTAGCTGCAGTC -3'

Sequencing Primer
(F):5'- GTGTGAAGGCAACCATATCTCTTCTG -3'
(R):5'- CAATTAGCTGCAGTCAGTTTCTG -3'
Posted On2014-10-02