Incidental Mutation 'R2190:Adgrg5'
ID238038
Institutional Source Beutler Lab
Gene Symbol Adgrg5
Ensembl Gene ENSMUSG00000061577
Gene Nameadhesion G protein-coupled receptor G5
SynonymsGpr114, PGR27, LOC382045
MMRRC Submission 040192-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2190 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94923694-94943280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94933951 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 73 (I73F)
Ref Sequence ENSEMBL: ENSMUSP00000074155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074570] [ENSMUST00000128308] [ENSMUST00000153448] [ENSMUST00000166802]
Predicted Effect probably damaging
Transcript: ENSMUST00000074570
AA Change: I73F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577
AA Change: I73F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128308
AA Change: I69F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577
AA Change: I69F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142991
Predicted Effect probably benign
Transcript: ENSMUST00000153448
SMART Domains Protein: ENSMUSP00000122780
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166802
AA Change: I73F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577
AA Change: I73F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion family of G-protein coupled receptors. Members of this family are characterized by long N-termini and multiple functional domains. They may play a role in the immune system as well as in the central nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,040,153 T56S probably damaging Het
Acbd6 A T 1: 155,624,906 H204L probably damaging Het
Acnat2 T A 4: 49,383,551 M1L probably benign Het
Ankrd52 A G 10: 128,383,618 T474A probably benign Het
Arid3a A G 10: 79,946,531 D252G possibly damaging Het
Aspg G T 12: 112,124,888 E501D probably damaging Het
Bicral A G 17: 46,825,123 I387T probably damaging Het
Bub1 T C 2: 127,810,725 N574S probably benign Het
Casr G A 16: 36,495,416 T764M probably damaging Het
Ccdc129 A G 6: 55,897,700 T212A possibly damaging Het
Ccdc60 A G 5: 116,157,580 S259P probably damaging Het
Ccne2 A T 4: 11,197,241 N181I probably benign Het
Chd4 A G 6: 125,114,297 D89G probably benign Het
Col25a1 C T 3: 130,584,715 P606S probably damaging Het
Dcc A G 18: 71,547,420 S582P possibly damaging Het
Dlg4 A G 11: 70,042,604 D619G probably damaging Het
Elavl2 C T 4: 91,264,094 V129I probably benign Het
Epha3 A G 16: 63,546,189 I965T probably benign Het
Fbxw16 G A 9: 109,436,671 S360L probably damaging Het
Fgf14 T C 14: 123,983,918 Y158C probably damaging Het
Gm44511 A G 6: 128,826,200 I16T possibly damaging Het
Has2 C A 15: 56,667,787 V511F probably benign Het
Heatr5b G A 17: 78,801,756 R1025C probably damaging Het
Hsd17b12 T C 2: 94,034,063 Y233C probably benign Het
Il1f5 A T 2: 24,280,819 I43F probably damaging Het
Inpp5b T A 4: 124,785,195 I465N probably damaging Het
Irak2 T A 6: 113,686,943 N423K probably damaging Het
Itga2 C A 13: 114,870,605 V396L probably benign Het
Lipo2 A T 19: 33,748,569 N94K probably damaging Het
Lrrc37a T C 11: 103,500,043 T1519A possibly damaging Het
Macf1 A G 4: 123,459,212 V1558A probably benign Het
Mocos C A 18: 24,664,057 H91Q probably benign Het
Myh14 G A 7: 44,661,063 T132I probably damaging Het
Nlrp2 A T 7: 5,319,238 D803E possibly damaging Het
Ntsr2 T A 12: 16,654,017 I173N probably damaging Het
Olfr1458 T G 19: 13,102,493 K270N probably damaging Het
Olfr299 A G 7: 86,466,365 Y318C possibly damaging Het
Pitx3 T C 19: 46,137,047 Y86C probably damaging Het
Pkp1 T C 1: 135,879,971 S520G probably benign Het
Pygo1 C T 9: 72,945,247 Q239* probably null Het
Rab13 A G 3: 90,223,544 E68G probably damaging Het
Rfx7 A G 9: 72,617,919 E797G probably benign Het
Slc5a1 T C 5: 33,104,593 probably null Het
Slco1c1 A G 6: 141,563,167 T518A probably benign Het
Spint1 A G 2: 119,238,180 I132V probably benign Het
Stard9 T A 2: 120,714,120 I4514N probably benign Het
Tenm3 T G 8: 48,395,544 S87R probably damaging Het
Thap4 G T 1: 93,750,659 P135Q probably damaging Het
Tmed9 A G 13: 55,593,343 E57G probably benign Het
Tnrc18 C T 5: 142,775,889 V594I unknown Het
Trmt1 A T 8: 84,689,841 K64* probably null Het
Usf2 A G 7: 30,955,181 V198A probably damaging Het
Usp14 A T 18: 10,007,835 C168S probably damaging Het
Vav3 C A 3: 109,562,814 T525K probably damaging Het
Vmn1r52 A G 6: 90,179,169 I152V probably benign Het
Vmn2r81 A G 10: 79,268,251 D236G possibly damaging Het
Wdr19 G A 5: 65,244,166 V975I possibly damaging Het
Other mutations in Adgrg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Adgrg5 APN 8 94937629 missense probably damaging 1.00
IGL02617:Adgrg5 APN 8 94933982 missense probably benign 0.01
R0483:Adgrg5 UTSW 8 94933508 missense possibly damaging 0.73
R0539:Adgrg5 UTSW 8 94938632 missense probably damaging 1.00
R0580:Adgrg5 UTSW 8 94937344 critical splice donor site probably null
R0650:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0652:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0828:Adgrg5 UTSW 8 94941785 splice site probably null
R1546:Adgrg5 UTSW 8 94941630 missense probably benign 0.27
R1567:Adgrg5 UTSW 8 94937698 missense probably damaging 0.97
R1695:Adgrg5 UTSW 8 94937745 missense probably damaging 1.00
R1753:Adgrg5 UTSW 8 94942052 missense possibly damaging 0.65
R1852:Adgrg5 UTSW 8 94937800 missense probably damaging 1.00
R2018:Adgrg5 UTSW 8 94934480 missense probably damaging 1.00
R2051:Adgrg5 UTSW 8 94942067 missense probably benign 0.01
R2299:Adgrg5 UTSW 8 94938576 missense possibly damaging 0.88
R2568:Adgrg5 UTSW 8 94934021 missense probably damaging 0.99
R4283:Adgrg5 UTSW 8 94937698 missense probably benign 0.21
R4512:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R4825:Adgrg5 UTSW 8 94941734 missense possibly damaging 0.77
R5422:Adgrg5 UTSW 8 94933952 missense probably damaging 1.00
R5427:Adgrg5 UTSW 8 94935102 missense probably benign 0.27
R6186:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R6522:Adgrg5 UTSW 8 94942068 missense probably benign 0.13
R6608:Adgrg5 UTSW 8 94941720 missense probably damaging 1.00
R6810:Adgrg5 UTSW 8 94933942 missense probably damaging 0.97
R6816:Adgrg5 UTSW 8 94941683 missense probably damaging 0.99
R7214:Adgrg5 UTSW 8 94934018 missense
X0027:Adgrg5 UTSW 8 94937338 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGGCTCTAAGACTTGCGTGG -3'
(R):5'- GAGAGGCCATAGAGCACTTC -3'

Sequencing Primer
(F):5'- CTCTAAGACTTGCGTGGGGGAC -3'
(R):5'- GAGGCCATAGAGCACTTCCTCTTTC -3'
Posted On2014-10-02