Incidental Mutation 'R2190:Fgf14'
ID238055
Institutional Source Beutler Lab
Gene Symbol Fgf14
Ensembl Gene ENSMUSG00000025551
Gene Namefibroblast growth factor 14
SynonymsFhf4
MMRRC Submission 040192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R2190 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123977907-124677127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123983918 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 158 (Y158C)
Ref Sequence ENSEMBL: ENSMUSP00000093185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026631] [ENSMUST00000095529]
Predicted Effect probably damaging
Transcript: ENSMUST00000026631
AA Change: Y153C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026631
Gene: ENSMUSG00000025551
AA Change: Y153C

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
FGF 69 200 1.75e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095529
AA Change: Y158C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093185
Gene: ENSMUSG00000025551
AA Change: Y158C

DomainStartEndE-ValueType
FGF 74 205 1.75e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190088
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. A mutation in this gene is associated with autosomal dominant cerebral ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display impaired balance and grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,040,153 T56S probably damaging Het
Acbd6 A T 1: 155,624,906 H204L probably damaging Het
Acnat2 T A 4: 49,383,551 M1L probably benign Het
Adgrg5 A T 8: 94,933,951 I73F probably damaging Het
Ankrd52 A G 10: 128,383,618 T474A probably benign Het
Arid3a A G 10: 79,946,531 D252G possibly damaging Het
Aspg G T 12: 112,124,888 E501D probably damaging Het
Bicral A G 17: 46,825,123 I387T probably damaging Het
Bub1 T C 2: 127,810,725 N574S probably benign Het
Casr G A 16: 36,495,416 T764M probably damaging Het
Ccdc129 A G 6: 55,897,700 T212A possibly damaging Het
Ccdc60 A G 5: 116,157,580 S259P probably damaging Het
Ccne2 A T 4: 11,197,241 N181I probably benign Het
Chd4 A G 6: 125,114,297 D89G probably benign Het
Col25a1 C T 3: 130,584,715 P606S probably damaging Het
Dcc A G 18: 71,547,420 S582P possibly damaging Het
Dlg4 A G 11: 70,042,604 D619G probably damaging Het
Elavl2 C T 4: 91,264,094 V129I probably benign Het
Epha3 A G 16: 63,546,189 I965T probably benign Het
Fbxw16 G A 9: 109,436,671 S360L probably damaging Het
Gm44511 A G 6: 128,826,200 I16T possibly damaging Het
Has2 C A 15: 56,667,787 V511F probably benign Het
Heatr5b G A 17: 78,801,756 R1025C probably damaging Het
Hsd17b12 T C 2: 94,034,063 Y233C probably benign Het
Il1f5 A T 2: 24,280,819 I43F probably damaging Het
Inpp5b T A 4: 124,785,195 I465N probably damaging Het
Irak2 T A 6: 113,686,943 N423K probably damaging Het
Itga2 C A 13: 114,870,605 V396L probably benign Het
Lipo2 A T 19: 33,748,569 N94K probably damaging Het
Lrrc37a T C 11: 103,500,043 T1519A possibly damaging Het
Macf1 A G 4: 123,459,212 V1558A probably benign Het
Mocos C A 18: 24,664,057 H91Q probably benign Het
Myh14 G A 7: 44,661,063 T132I probably damaging Het
Nlrp2 A T 7: 5,319,238 D803E possibly damaging Het
Ntsr2 T A 12: 16,654,017 I173N probably damaging Het
Olfr1458 T G 19: 13,102,493 K270N probably damaging Het
Olfr299 A G 7: 86,466,365 Y318C possibly damaging Het
Pitx3 T C 19: 46,137,047 Y86C probably damaging Het
Pkp1 T C 1: 135,879,971 S520G probably benign Het
Pygo1 C T 9: 72,945,247 Q239* probably null Het
Rab13 A G 3: 90,223,544 E68G probably damaging Het
Rfx7 A G 9: 72,617,919 E797G probably benign Het
Slc5a1 T C 5: 33,104,593 probably null Het
Slco1c1 A G 6: 141,563,167 T518A probably benign Het
Spint1 A G 2: 119,238,180 I132V probably benign Het
Stard9 T A 2: 120,714,120 I4514N probably benign Het
Tenm3 T G 8: 48,395,544 S87R probably damaging Het
Thap4 G T 1: 93,750,659 P135Q probably damaging Het
Tmed9 A G 13: 55,593,343 E57G probably benign Het
Tnrc18 C T 5: 142,775,889 V594I unknown Het
Trmt1 A T 8: 84,689,841 K64* probably null Het
Usf2 A G 7: 30,955,181 V198A probably damaging Het
Usp14 A T 18: 10,007,835 C168S probably damaging Het
Vav3 C A 3: 109,562,814 T525K probably damaging Het
Vmn1r52 A G 6: 90,179,169 I152V probably benign Het
Vmn2r81 A G 10: 79,268,251 D236G possibly damaging Het
Wdr19 G A 5: 65,244,166 V975I possibly damaging Het
Other mutations in Fgf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Fgf14 APN 14 123980372 missense possibly damaging 0.51
IGL02733:Fgf14 APN 14 123983801 missense probably damaging 1.00
IGL02939:Fgf14 APN 14 124132479 missense possibly damaging 0.82
R0517:Fgf14 UTSW 14 123983784 missense probably damaging 1.00
R0608:Fgf14 UTSW 14 124676603 missense probably damaging 0.99
R1034:Fgf14 UTSW 14 124132534 missense probably damaging 0.96
R1183:Fgf14 UTSW 14 124676524 missense probably benign 0.03
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1466:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1584:Fgf14 UTSW 14 124676539 missense probably benign 0.19
R1768:Fgf14 UTSW 14 124676512 missense probably benign 0.00
R2307:Fgf14 UTSW 14 123983822 missense probably damaging 1.00
R3743:Fgf14 UTSW 14 124676620 missense probably benign
R3847:Fgf14 UTSW 14 123980389 missense probably benign 0.05
R4859:Fgf14 UTSW 14 124192433 missense possibly damaging 0.78
R5529:Fgf14 UTSW 14 123980455 missense probably damaging 1.00
R5655:Fgf14 UTSW 14 124192416 missense probably benign
R6242:Fgf14 UTSW 14 124676528 missense probably benign 0.02
R6958:Fgf14 UTSW 14 124676597 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAAATTAAAGTCTGCAGCAGC -3'
(R):5'- TATAGAGAGCTTCTGCATGCAGG -3'

Sequencing Primer
(F):5'- CACTCAAGAGGATGATGCATGTG -3'
(R):5'- ATGCAGGAGGACTCAGTTCCATC -3'
Posted On2014-10-02