Incidental Mutation 'R2191:Rsf1'
ID238106
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Nameremodeling and spacing factor 1
Synonymsp325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission 040193-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2191 (G1)
Quality Score215
Status Not validated
Chromosome7
Chromosomal Location97579889-97692778 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCG to GCGACGGCGACG at 97579907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000178078]
Predicted Effect unknown
Transcript: ENSMUST00000042399
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Abcb5 A C 12: 118,867,956 N1220K probably damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Actn1 A T 12: 80,171,802 L736* probably null Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Cr2 T A 1: 195,163,381 I465F possibly damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Omt2b G A 9: 78,328,175 probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc13a1 T G 6: 24,134,397 E162D possibly damaging Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Stab1 A T 14: 31,142,800 M66K probably benign Het
Stab1 T C 14: 31,159,270 N601S probably damaging Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTTGAAGTCGTAGAGGG -3'
(R):5'- CAGGGTATCTATGGAGAGCTAAAGC -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On2014-10-02