Incidental Mutation 'R2191:Omt2b'
ID238115
Institutional Source Beutler Lab
Gene Symbol Omt2b
Ensembl Gene ENSMUSG00000038750
Gene Nameoocyte maturation, beta
SynonymsOM2b
MMRRC Submission 040193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2191 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location78327589-78329620 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 78328175 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000034902] [ENSMUST00000043734] [ENSMUST00000125479] [ENSMUST00000129247] [ENSMUST00000186336] [ENSMUST00000187667]
Predicted Effect probably benign
Transcript: ENSMUST00000034902
SMART Domains Protein: ENSMUSP00000034902
Gene: ENSMUSG00000057933

DomainStartEndE-ValueType
Pfam:GST_N 5 77 5.1e-23 PFAM
Pfam:GST_C 99 192 8.9e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000043734
AA Change: C13Y
SMART Domains Protein: ENSMUSP00000036132
Gene: ENSMUSG00000038750
AA Change: C13Y

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125479
SMART Domains Protein: ENSMUSP00000115517
Gene: ENSMUSG00000057933

DomainStartEndE-ValueType
Pfam:GST_N 5 77 1.1e-21 PFAM
Pfam:GST_C 78 182 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129247
SMART Domains Protein: ENSMUSP00000117101
Gene: ENSMUSG00000057933

DomainStartEndE-ValueType
Pfam:GST_N 5 77 1.1e-21 PFAM
Pfam:GST_C 78 179 1.2e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186336
AA Change: C13Y
Predicted Effect unknown
Transcript: ENSMUST00000187667
AA Change: C13Y
SMART Domains Protein: ENSMUSP00000139767
Gene: ENSMUSG00000038750
AA Change: C13Y

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187890
Predicted Effect probably benign
Transcript: ENSMUST00000189243
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Abcb5 A C 12: 118,867,956 N1220K probably damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Actn1 A T 12: 80,171,802 L736* probably null Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Cr2 T A 1: 195,163,381 I465F possibly damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc13a1 T G 6: 24,134,397 E162D possibly damaging Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Stab1 A T 14: 31,142,800 M66K probably benign Het
Stab1 T C 14: 31,159,270 N601S probably damaging Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Omt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Omt2b APN 9 78328572 missense possibly damaging 0.66
R0497:Omt2b UTSW 9 78328231 unclassified probably benign
R0789:Omt2b UTSW 9 78328165 unclassified probably benign
R1526:Omt2b UTSW 9 78328138 unclassified probably benign
R2192:Omt2b UTSW 9 78328175 unclassified probably benign
R4568:Omt2b UTSW 9 78328247 unclassified probably benign
R5884:Omt2b UTSW 9 78328557 missense probably benign 0.00
R6287:Omt2b UTSW 9 78328261 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGAGCTGGCAGGAATGTG -3'
(R):5'- GAAATTCTGGGACTTTGGTAGC -3'

Sequencing Primer
(F):5'- ATGGAGCCCTGGCCAATAG -3'
(R):5'- TTGGTAGCAATTGCCAGACC -3'
Posted On2014-10-02