Incidental Mutation 'R2191:Actn1'
ID238129
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission 040193-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R2191 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 80171802 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 736 (L736*)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably null
Transcript: ENSMUST00000021554
AA Change: L736*
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: L736*

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167327
AA Change: L736*
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: L736*

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,078,866 S716P possibly damaging Het
Abcb5 A C 12: 118,867,956 N1220K probably damaging Het
Acsl3 A T 1: 78,699,140 E479D probably damaging Het
Adcyap1 A G 17: 93,200,026 S5G possibly damaging Het
Adgrv1 T C 13: 81,566,290 N958S possibly damaging Het
Armc1 T A 3: 19,134,061 N274Y probably damaging Het
Atp9b G A 18: 80,753,051 R926W probably damaging Het
Cacna1e G T 1: 154,443,845 Q1370K probably damaging Het
Ccdc129 A T 6: 55,967,719 Q475L probably benign Het
Cdip1 C T 16: 4,770,063 S12N probably benign Het
Chrna3 T A 9: 55,016,045 I160F probably damaging Het
Cnot1 A G 8: 95,761,426 I534T probably damaging Het
Cr2 T A 1: 195,163,381 I465F possibly damaging Het
Daw1 A G 1: 83,192,663 D232G probably benign Het
Dcaf6 T C 1: 165,422,864 T144A probably benign Het
Dhx30 A T 9: 110,086,118 probably null Het
Dnah7a A G 1: 53,605,875 S1001P possibly damaging Het
Dnajb9 T C 12: 44,207,073 T184A probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edem3 T A 1: 151,796,883 V450D probably damaging Het
Ephb6 G T 6: 41,616,085 R419L possibly damaging Het
Fbxo10 G C 4: 45,044,811 P608R probably damaging Het
Flrt1 A G 19: 7,095,829 I451T probably damaging Het
Gm6309 A T 5: 146,168,871 V161E possibly damaging Het
Gm884 A C 11: 103,618,967 probably benign Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Igsf1 C A X: 49,783,150 L714F probably damaging Het
Inpp4b C T 8: 81,997,302 P488S probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Kdm2a A T 19: 4,356,931 probably null Het
Khdrbs3 G T 15: 69,092,960 V249F probably damaging Het
Kmt2d A T 15: 98,861,049 probably null Het
Laptm4a T C 12: 8,922,296 probably null Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Myo18a A G 11: 77,818,615 D138G probably damaging Het
Nlrp9b A T 7: 20,023,662 I275L probably benign Het
Nol6 C T 4: 41,118,720 R719H probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Olfr441 T C 6: 43,116,065 S108P probably benign Het
Olfr937 A T 9: 39,060,405 I87K probably benign Het
Omt2b G A 9: 78,328,175 probably benign Het
Pclo C T 5: 14,713,848 L4112F unknown Het
Pglyrp2 T C 17: 32,415,957 N477S probably benign Het
Phf20 T C 2: 156,276,654 V426A probably benign Het
Pla2g4e CTT CTTT 2: 120,191,199 probably null Het
Plagl1 A C 10: 13,128,941 probably benign Het
Ppip5k2 A G 1: 97,744,110 V479A probably damaging Het
Prkdc A C 16: 15,698,824 T1021P probably damaging Het
Rdh7 C T 10: 127,888,598 V6I probably benign Het
Rictor A T 15: 6,759,614 H237L probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Rttn T C 18: 89,095,648 probably null Het
Setd5 C T 6: 113,111,429 Q173* probably null Het
Sipa1l1 T A 12: 82,396,691 Y918* probably null Het
Slc13a1 T G 6: 24,134,397 E162D possibly damaging Het
Slc39a9 G A 12: 80,662,527 A52T probably damaging Het
Srebf1 T C 11: 60,220,539 D2G probably damaging Het
Stab1 A T 14: 31,142,800 M66K probably benign Het
Stab1 T C 14: 31,159,270 N601S probably damaging Het
Sv2b C T 7: 75,124,088 G545D probably damaging Het
Syt5 G A 7: 4,543,089 Q101* probably null Het
Thada A G 17: 84,446,521 F341L probably benign Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Tmem67 C G 4: 12,069,413 probably null Het
Tonsl G T 15: 76,632,680 L917M probably damaging Het
Ttk A G 9: 83,862,183 K519E probably damaging Het
Ttn T C 2: 76,707,134 T34817A probably benign Het
Ubr1 A T 2: 120,926,047 S700T probably damaging Het
Unc13b C A 4: 43,245,566 C1312* probably null Het
Usp36 A G 11: 118,285,023 L104P possibly damaging Het
Vmn1r216 T C 13: 23,099,233 F29L probably benign Het
Vmn1r225 T C 17: 20,502,885 I196T probably damaging Het
Vmn1r50 T C 6: 90,108,139 F289L probably benign Het
Ythdf3 T C 3: 16,203,211 probably benign Het
Zfp507 T A 7: 35,794,843 K258N probably damaging Het
Zscan5b A G 7: 6,231,443 H156R possibly damaging Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCAAGGACCAGGCTTATG -3'
(R):5'- TGTCCCTCCTGATGGTGATAC -3'

Sequencing Primer
(F):5'- CCGGTCAAAGTGGTTGAA -3'
(R):5'- CTGCCATAGGGGTCCTACAATTGAG -3'
Posted On2014-10-02