Incidental Mutation 'R2192:Nbeal1'
ID238163
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 040194-MU
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60281895 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 2055 (L2055H)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000162291]
Predicted Effect unknown
Transcript: ENSMUST00000035569
AA Change: L788H
SMART Domains Protein: ENSMUSP00000049393
Gene: ENSMUSG00000073664
AA Change: L788H

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
Pfam:DUF4704 851 1130 3.4e-39 PFAM
low complexity region 1383 1401 N/A INTRINSIC
Pfam:DUF4800 1575 1828 6.3e-126 PFAM
coiled coil region 1859 1882 N/A INTRINSIC
Pfam:PH_BEACH 1889 1975 2e-24 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159344
AA Change: L68H
SMART Domains Protein: ENSMUSP00000124850
Gene: ENSMUSG00000073664
AA Change: L68H

DomainStartEndE-ValueType
Beach 31 246 4.21e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160834
AA Change: L2055H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: L2055H

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162291
SMART Domains Protein: ENSMUSP00000125592
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 114 132 N/A INTRINSIC
low complexity region 580 596 N/A INTRINSIC
Pfam:PH_BEACH 613 706 9.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190958
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Celsr1 A G 15: 85,916,723 L2507P possibly damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Clstn3 A T 6: 124,459,207 D194E probably damaging Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Helz2 T A 2: 181,229,048 K2832* probably null Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1233 A T 2: 89,339,665 Y212* probably null Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Wdfy3 C T 5: 101,907,542 R1554Q possibly damaging Het
Zfp112 A T 7: 24,125,438 Q277L probably damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGTGGTGAGTTTGTATAAATCTC -3'
(R):5'- CTGGAGAGATAGCTTAGTGTACG -3'

Sequencing Primer
(F):5'- TACAGCTCAGTGGTAGAATGCTC -3'
(R):5'- CTGTACAAATTCAAACAGTGAGT -3'
Posted On2014-10-02