Incidental Mutation 'R2192:Olfr1233'
ID238173
Institutional Source Beutler Lab
Gene Symbol Olfr1233
Ensembl Gene ENSMUSG00000075091
Gene Nameolfactory receptor 1233
SynonymsGA_x6K02T2Q125-50784973-50784056, MOR238-1
MMRRC Submission 040194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89333208-89342398 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 89339665 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 212 (Y212*)
Ref Sequence ENSEMBL: ENSMUSP00000149446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099784] [ENSMUST00000215469] [ENSMUST00000216561]
Predicted Effect probably null
Transcript: ENSMUST00000099784
AA Change: Y212*
SMART Domains Protein: ENSMUSP00000097372
Gene: ENSMUSG00000075091
AA Change: Y212*

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.1e-46 PFAM
Pfam:7tm_1 35 281 2.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215018
Predicted Effect probably null
Transcript: ENSMUST00000215469
AA Change: Y212*
Predicted Effect probably null
Transcript: ENSMUST00000216561
AA Change: Y212*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Celsr1 A G 15: 85,916,723 L2507P possibly damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Clstn3 A T 6: 124,459,207 D194E probably damaging Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Helz2 T A 2: 181,229,048 K2832* probably null Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Nbeal1 T A 1: 60,281,895 L2055H probably damaging Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Wdfy3 C T 5: 101,907,542 R1554Q possibly damaging Het
Zfp112 A T 7: 24,125,438 Q277L probably damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Olfr1233
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr1233 APN 2 89340022 missense probably benign 0.01
IGL02130:Olfr1233 APN 2 89339583 missense probably damaging 1.00
IGL02264:Olfr1233 APN 2 89339684 missense probably benign 0.33
IGL03155:Olfr1233 APN 2 89339966 missense probably damaging 1.00
R0412:Olfr1233 UTSW 2 89340078 missense probably benign 0.03
R0558:Olfr1233 UTSW 2 89340236 missense probably benign 0.00
R0614:Olfr1233 UTSW 2 89339985 missense probably damaging 0.99
R1138:Olfr1233 UTSW 2 89340090 missense probably benign 0.03
R1969:Olfr1233 UTSW 2 89340296 missense probably damaging 1.00
R4417:Olfr1233 UTSW 2 89339987 missense probably benign 0.11
R5329:Olfr1233 UTSW 2 89339459 missense probably damaging 1.00
R5394:Olfr1233 UTSW 2 89339462 missense probably damaging 1.00
R5645:Olfr1233 UTSW 2 89339705 missense possibly damaging 0.94
R5949:Olfr1233 UTSW 2 89339885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCTGCATTCCTTACAGTG -3'
(R):5'- GGACAGATACTCGTTACTCTCTGG -3'

Sequencing Primer
(F):5'- GCATTCCTTACAGTGTAGATAATTGG -3'
(R):5'- AGATACTCGTTACTCTCTGGATTCC -3'
Posted On2014-10-02