Incidental Mutation 'R2192:Helz2'
ID238179
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 040194-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 181229048 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 2832 (K2832*)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably null
Transcript: ENSMUST00000094203
AA Change: K2876*
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: K2876*

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108831
AA Change: K2876*
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: K2876*

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121484
AA Change: K2832*
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: K2832*

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Celsr1 A G 15: 85,916,723 L2507P possibly damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Clstn3 A T 6: 124,459,207 D194E probably damaging Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Nbeal1 T A 1: 60,281,895 L2055H probably damaging Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1233 A T 2: 89,339,665 Y212* probably null Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Wdfy3 C T 5: 101,907,542 R1554Q possibly damaging Het
Zfp112 A T 7: 24,125,438 Q277L probably damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGTCAAGGTGGTTTTGCCC -3'
(R):5'- CTCATGCAAAGAGGAGTCACC -3'

Sequencing Primer
(F):5'- CAAGGTGGTTTTGCCCTGAGC -3'
(R):5'- GAGTGACTGTGACCTCTATTACCAAG -3'
Posted On2014-10-02