Incidental Mutation 'R2192:Celsr1'
ID238242
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
MMRRC Submission 040194-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.735) question?
Stock #R2192 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85916723 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2507 (L2507P)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016172
AA Change: L2507P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: L2507P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226840
AA Change: L1140P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227450
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d A T 2: 131,561,369 M267K probably damaging Het
Aen T C 7: 78,906,045 probably null Het
AI464131 A G 4: 41,497,704 I642T probably damaging Het
Ano2 A G 6: 126,015,539 D825G probably damaging Het
Bdh2 T C 3: 135,295,264 S142P probably damaging Het
Ces3a T C 8: 105,055,580 F308S probably benign Het
Chd4 T A 6: 125,105,357 M603K probably damaging Het
Cit T C 5: 115,968,009 V984A probably benign Het
Clstn3 A T 6: 124,459,207 D194E probably damaging Het
Ctdp1 T C 18: 80,449,481 R600G probably benign Het
Ctnnd1 C T 2: 84,609,563 G801D probably damaging Het
Dgkg A G 16: 22,588,299 F179L probably damaging Het
Dlg3 G A X: 100,774,221 D379N probably damaging Het
Drd2 G T 9: 49,403,271 R267S probably benign Het
Dsg1b T C 18: 20,409,618 *1061Q probably null Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Edc3 T C 9: 57,713,543 V49A probably damaging Het
Ern1 G A 11: 106,409,924 T548I probably benign Het
Fam186a T C 15: 99,940,311 D2684G possibly damaging Het
Fam20a A G 11: 109,674,623 M454T probably benign Het
Fbp2 A G 13: 62,858,242 M19T possibly damaging Het
Frmd4b A T 6: 97,487,616 C47S probably damaging Het
Gm7173 C T X: 79,410,612 R1646Q probably damaging Het
Gtf2h1 T A 7: 46,815,323 I388N possibly damaging Het
Hectd4 T C 5: 121,315,143 V571A possibly damaging Het
Helz2 T A 2: 181,229,048 K2832* probably null Het
Herc1 T A 9: 66,465,406 D3081E probably damaging Het
Hmcn1 A T 1: 150,715,815 S1878T probably damaging Het
Iars A G 13: 49,688,129 probably null Het
Il17rd A T 14: 27,094,878 K180M probably damaging Het
Ints6l T A X: 56,504,750 H678Q probably benign Het
Khdrbs1 A G 4: 129,720,037 probably null Het
Lce3a A C 3: 92,925,530 S88A unknown Het
Lgals12 C T 19: 7,601,241 probably null Het
Lnpk T C 2: 74,569,029 T57A probably benign Het
Lrp2bp C T 8: 46,013,169 T105I probably benign Het
Lrrc4c C G 2: 97,629,312 N94K possibly damaging Het
Mag A T 7: 30,900,641 Y571* probably null Het
Mbd1 T A 18: 74,277,378 D583E probably damaging Het
Mill1 T A 7: 18,264,619 Y251* probably null Het
Mllt10 T C 2: 18,207,060 I928T probably benign Het
Ms4a18 T C 19: 11,013,665 T22A probably benign Het
Mtmr14 T C 6: 113,280,739 F250L probably damaging Het
Mtmr3 A T 11: 4,499,032 W244R probably damaging Het
Nat10 C A 2: 103,726,177 E885D probably benign Het
Nbeal1 T A 1: 60,281,895 L2055H probably damaging Het
Necab3 T A 2: 154,547,079 I192F possibly damaging Het
Nedd4 T A 9: 72,742,718 N783K probably damaging Het
Nf2 A T 11: 4,799,899 W61R probably damaging Het
Nox4 T A 7: 87,374,380 F491L probably benign Het
Olfr1104 A G 2: 87,022,511 V11A probably benign Het
Olfr1233 A T 2: 89,339,665 Y212* probably null Het
Olfr1262 T A 2: 90,002,430 I8N probably damaging Het
Omt2b G A 9: 78,328,175 probably benign Het
Osbpl5 A T 7: 143,693,859 Y723* probably null Het
Otop2 T C 11: 115,326,931 S198P possibly damaging Het
Pgam5 T G 5: 110,265,919 H126P probably damaging Het
Phip A T 9: 82,871,815 N1625K probably damaging Het
Phospho2 T A 2: 69,796,107 Y202* probably null Het
Pkd1l3 T A 8: 109,620,524 H176Q unknown Het
Plxdc2 A G 2: 16,565,336 R109G probably damaging Het
Prorsd1 T C 11: 29,513,592 K57E probably benign Het
Rnf150 A T 8: 82,864,391 R128W probably damaging Het
Samm50 G A 15: 84,200,424 probably null Het
Skint6 A T 4: 112,865,712 Y889* probably null Het
Slc35b1 T C 11: 95,385,814 Y40H probably damaging Het
Speg A G 1: 75,417,727 H1722R probably damaging Het
Suz12 T C 11: 80,022,198 L356P probably damaging Het
Tln2 T G 9: 67,355,221 I585L probably damaging Het
Trim2 G A 3: 84,190,918 Q359* probably null Het
Ttc28 T C 5: 111,223,496 Y635H probably damaging Het
Ttn C T 2: 76,713,205 E33146K probably damaging Het
Vcp G T 4: 42,982,547 T715K probably benign Het
Vmn1r230 T A 17: 20,847,093 N181K probably benign Het
Vmn2r17 T A 5: 109,434,278 M511K possibly damaging Het
Wdfy3 C T 5: 101,907,542 R1554Q possibly damaging Het
Zfp112 A T 7: 24,125,438 Q277L probably damaging Het
Zfp850 T C 7: 27,985,195 E42G probably damaging Het
Zfp976 G A 7: 42,613,271 P381S probably damaging Het
Zzef1 A T 11: 72,910,156 probably null Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCATGCCCGAGTGGTAG -3'
(R):5'- GGTCTTCAATATCTAACAGCCATC -3'

Sequencing Primer
(F):5'- TGGTAGCACTCAGGGTAGC -3'
(R):5'- CAGCCATCACAGTATCTGTTCAAATG -3'
Posted On2014-10-02