Incidental Mutation 'R2193:Olfr332'
ID238275
Institutional Source Beutler Lab
Gene Symbol Olfr332
Ensembl Gene ENSMUSG00000050813
Gene Nameolfactory receptor 332
SynonymsGA_x6K02T2NKPP-926908-927915, MOR284-2
MMRRC Submission 040195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2193 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58487950-58492555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58489906 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 283 (M283K)
Ref Sequence ENSEMBL: ENSMUSP00000136008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180165] [ENSMUST00000203744]
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000180165
AA Change: M283K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136008
Gene: ENSMUSG00000050813
AA Change: M283K

DomainStartEndE-ValueType
Pfam:7tm_1 40 289 6.8e-33 PFAM
Pfam:7tm_4 138 282 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203744
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 T C 7: 44,253,569 R289G probably benign Het
Bfar A G 16: 13,697,471 N183D probably benign Het
Cdca3 A G 6: 124,831,446 T69A probably damaging Het
Ces1b A T 8: 93,079,877 C14S probably benign Het
Clcn3 T A 8: 60,929,187 I456F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcpp2 A C 17: 23,900,419 D69A probably damaging Het
Dlgap2 T A 8: 14,743,431 I475N possibly damaging Het
Dnah6 T A 6: 73,138,640 M1592L probably damaging Het
Dscaml1 A G 9: 45,685,234 Q792R probably benign Het
Eif2ak4 A G 2: 118,422,266 I440V probably benign Het
Frrs1 T C 3: 116,878,345 S31P probably damaging Het
Isoc2b T C 7: 4,850,824 H117R probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Klf5 C T 14: 99,298,970 probably benign Het
Ltn1 G A 16: 87,427,647 S63F probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Oas1f A C 5: 120,851,585 T196P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocln T C 13: 100,539,904 D27G probably damaging Het
Olfr1390 A G 11: 49,340,943 H137R possibly damaging Het
Rasgrf2 A C 13: 92,023,713 probably null Het
Sars2 G T 7: 28,748,997 V268L probably damaging Het
Sin3a T A 9: 57,117,477 S1040R possibly damaging Het
Vps9d1 A T 8: 123,252,665 Y39N probably damaging Het
Other mutations in Olfr332
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Olfr332 APN 11 58490539 missense probably damaging 1.00
R1671:Olfr332 UTSW 11 58490609 missense possibly damaging 0.63
R2393:Olfr332 UTSW 11 58490720 missense probably benign 0.20
R4713:Olfr332 UTSW 11 58490087 missense probably benign 0.01
R5328:Olfr332 UTSW 11 58490429 missense possibly damaging 0.91
R5636:Olfr332 UTSW 11 58490051 missense probably damaging 1.00
R6092:Olfr332 UTSW 11 58490074 missense probably damaging 1.00
R7011:Olfr332 UTSW 11 58490144 missense possibly damaging 0.69
R7172:Olfr332 UTSW 11 58489745 missense unknown
R7427:Olfr332 UTSW 11 58489780 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGATGAGAACTGAGAACAACATTCC -3'
(R):5'- TCCTCAGGATGAACTCTCCC -3'

Sequencing Primer
(F):5'- ACAAGGCTCTGTTTCCAATCTGG -3'
(R):5'- TCAGGATGAACTCTCCCAAGGG -3'
Posted On2014-10-02