Incidental Mutation 'R2194:Zfp607a'
ID238292
Institutional Source Beutler Lab
Gene Symbol Zfp607a
Ensembl Gene ENSMUSG00000020420
Gene Namezinc finger protein 607A
SynonymsZfp607, 4732475C15Rik
MMRRC Submission 040196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2194 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27857527-27880825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27879380 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 625 (E625G)
Ref Sequence ENSEMBL: ENSMUSP00000146006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053722] [ENSMUST00000205534] [ENSMUST00000205715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053722
AA Change: E625G

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051496
Gene: ENSMUSG00000020420
AA Change: E625G

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.91e-2 SMART
ZnF_C2H2 201 223 3.44e-4 SMART
ZnF_C2H2 229 251 3.83e-2 SMART
ZnF_C2H2 257 279 4.87e-4 SMART
ZnF_C2H2 285 307 1.38e-3 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 2.86e-1 SMART
ZnF_C2H2 369 391 5.14e-3 SMART
ZnF_C2H2 397 419 1.2e-3 SMART
ZnF_C2H2 425 447 4.47e-3 SMART
ZnF_C2H2 453 475 1.1e-2 SMART
ZnF_C2H2 481 503 1.45e-2 SMART
ZnF_C2H2 509 531 1.12e-3 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 8.34e-3 SMART
ZnF_C2H2 593 615 1.12e-3 SMART
ZnF_C2H2 621 643 6.42e-4 SMART
ZnF_C2H2 649 671 6.23e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205534
AA Change: E625G

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205715
AA Change: E625G

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206136
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh2 T C 18: 16,640,448 T275A probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fkbp5 T C 17: 28,438,027 D72G probably benign Het
Gm8104 T C 14: 43,101,560 M69T possibly damaging Het
Greb1 T C 12: 16,690,908 E1391G probably benign Het
Hif1a A G 12: 73,930,747 N183S probably damaging Het
Hnrnpul1 A G 7: 25,725,922 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ighmbp2 T C 19: 3,265,116 D768G probably benign Het
Kitl T G 10: 100,016,037 probably null Het
Mfsd4b4 T A 10: 39,892,923 N104I probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr331 T C 11: 58,501,642 K305E probably damaging Het
Pcdhb4 T C 18: 37,308,735 V366A probably damaging Het
Polb C T 8: 22,647,467 R89H probably benign Het
Rfc4 TTTGTTGTTGTTG TTTGTTGTTG 16: 23,114,152 probably benign Het
Rnf40 C A 7: 127,597,235 A785D probably damaging Het
St7 A G 6: 17,942,719 E494G probably damaging Het
Tnks1bp1 A G 2: 85,063,065 E1112G probably benign Het
Other mutations in Zfp607a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Zfp607a APN 7 27877789 missense possibly damaging 0.55
IGL01019:Zfp607a APN 7 27878617 missense probably damaging 1.00
IGL01412:Zfp607a APN 7 27878684 missense probably damaging 0.99
IGL03206:Zfp607a APN 7 27877823 missense possibly damaging 0.52
R0071:Zfp607a UTSW 7 27878269 missense probably damaging 0.96
R0304:Zfp607a UTSW 7 27879212 missense possibly damaging 0.92
R0685:Zfp607a UTSW 7 27878476 missense probably damaging 0.97
R0726:Zfp607a UTSW 7 27879149 missense probably benign 0.00
R1201:Zfp607a UTSW 7 27879311 missense probably damaging 1.00
R1304:Zfp607a UTSW 7 27865575 missense probably benign 0.00
R1648:Zfp607a UTSW 7 27879068 missense probably benign 0.02
R1732:Zfp607a UTSW 7 27878459 missense probably damaging 1.00
R3793:Zfp607a UTSW 7 27878906 missense probably benign 0.01
R3808:Zfp607a UTSW 7 27879401 missense probably benign 0.01
R4296:Zfp607a UTSW 7 27865648 missense probably damaging 1.00
R4786:Zfp607a UTSW 7 27879413 missense probably damaging 1.00
R4792:Zfp607a UTSW 7 27878653 missense probably benign 0.23
R4915:Zfp607a UTSW 7 27878560 missense probably benign 0.00
R4950:Zfp607a UTSW 7 27878751 missense probably damaging 1.00
R5123:Zfp607a UTSW 7 27879098 missense probably damaging 1.00
R5217:Zfp607a UTSW 7 27877844 missense probably damaging 0.97
R5270:Zfp607a UTSW 7 27878305 nonsense probably null
R5403:Zfp607a UTSW 7 27879319 missense possibly damaging 0.54
R6010:Zfp607a UTSW 7 27877829 nonsense probably null
R6224:Zfp607a UTSW 7 27878582 missense probably damaging 1.00
R6939:Zfp607a UTSW 7 27879048 nonsense probably null
R6953:Zfp607a UTSW 7 27878365 missense possibly damaging 0.59
R7082:Zfp607a UTSW 7 27878758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAATCATCGCTCAAACCTCAAGC -3'
(R):5'- AACCAAGCTTGACTAATAGCCTTC -3'

Sequencing Primer
(F):5'- CATTCTGATGAGAGACCCTTTGAG -3'
(R):5'- CTCACCAGCATGAATTCTTTGATG -3'
Posted On2014-10-02