Incidental Mutation 'R2196:Acvr2a'
ID238338
Institutional Source Beutler Lab
Gene Symbol Acvr2a
Ensembl Gene ENSMUSG00000052155
Gene Nameactivin receptor IIA
SynonymsActRIIa, Acvr2, tActRII
MMRRC Submission 040198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2196 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location48814109-48903269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48870312 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 27 (T27S)
Ref Sequence ENSEMBL: ENSMUSP00000067305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063886]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF THE TYPE II ACTIVIN RECEPTOR [X-RAY DIFFRACTION]
Crystal Structure of the BMP7/ActRII Extracellular Domain Complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063886
AA Change: T27S

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067305
Gene: ENSMUSG00000052155
AA Change: T27S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Activin_recp 28 118 5e-10 PFAM
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Pkinase_Tyr 192 479 1.2e-31 PFAM
Pfam:Pkinase 196 481 7.6e-34 PFAM
low complexity region 486 502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: While most mice homozygous for targeted mutations that inactivate this gene appear normal, a few display skeletal and facial abnormalities. As adults, follicle-stimulating hormone is suppressed, affecting reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Bnipl T A 3: 95,249,870 R47S possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cep55 T A 19: 38,069,110 Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Enam A G 5: 88,502,744 D704G probably damaging Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Tnn G C 1: 160,097,228 Y1185* probably null Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Vmn2r93 C T 17: 18,305,166 S362L probably damaging Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Acvr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Acvr2a APN 2 48873052 splice site probably benign
IGL01551:Acvr2a APN 2 48897059 missense probably damaging 1.00
IGL01913:Acvr2a APN 2 48899613 missense probably damaging 1.00
IGL02100:Acvr2a APN 2 48898618 splice site probably benign
IGL02210:Acvr2a APN 2 48898526 missense probably damaging 0.99
R0864:Acvr2a UTSW 2 48894786 splice site probably benign
R1371:Acvr2a UTSW 2 48899616 missense probably damaging 1.00
R1676:Acvr2a UTSW 2 48873083 missense probably benign 0.00
R2876:Acvr2a UTSW 2 48892178 missense probably damaging 1.00
R3721:Acvr2a UTSW 2 48892138 missense probably damaging 1.00
R3763:Acvr2a UTSW 2 48870319 missense possibly damaging 0.87
R4401:Acvr2a UTSW 2 48899702 missense probably benign
R4724:Acvr2a UTSW 2 48870435 missense probably damaging 1.00
R4921:Acvr2a UTSW 2 48893541 missense possibly damaging 0.51
R5060:Acvr2a UTSW 2 48890299 missense probably damaging 0.96
R5347:Acvr2a UTSW 2 48892154 missense probably damaging 1.00
R5953:Acvr2a UTSW 2 48890404 missense probably damaging 1.00
R6892:Acvr2a UTSW 2 48897075 missense probably damaging 1.00
Z1088:Acvr2a UTSW 2 48870373 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTAAAGCATGGCCATTC -3'
(R):5'- GAAGGAAAGTCACTGAACTCCATC -3'

Sequencing Primer
(F):5'- GCATGGCCATTCAAATGCAAAGTTG -3'
(R):5'- GTCATAGCAGTTGATATCATCCAGCC -3'
Posted On2014-10-02