Incidental Mutation 'R2196:Bnipl'
ID238344
Institutional Source Beutler Lab
Gene Symbol Bnipl
Ensembl Gene ENSMUSG00000028115
Gene NameBCL2/adenovirus E1B 19kD interacting protein like
SynonymsPP753, BNIPL1, 1700128A13Rik, BNIP-S, BNIPL2, BNIPL, BNIPL-2, BNIPL-1
MMRRC Submission 040198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R2196 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95241271-95251193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95249870 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 47 (R47S)
Ref Sequence ENSEMBL: ENSMUSP00000102813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015855] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000125515] [ENSMUST00000137250]
Predicted Effect probably benign
Transcript: ENSMUST00000015855
SMART Domains Protein: ENSMUSP00000015855
Gene: ENSMUSG00000015711

DomainStartEndE-ValueType
Pfam:DHH 19 181 2.5e-10 PFAM
DHHA2 215 359 1.88e-33 SMART
Predicted Effect silent
Transcript: ENSMUST00000098871
SMART Domains Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 4.5e-38 PFAM
Pfam:CRAL_TRIO_2 162 273 7.7e-16 PFAM
Pfam:CRAL_TRIO 196 263 3.2e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107195
AA Change: R47S

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
SEC14 193 348 7.89e-13 SMART
Predicted Effect silent
Transcript: ENSMUST00000125515
SMART Domains Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:BNIP2 48 178 3.7e-38 PFAM
Pfam:CRAL_TRIO_2 168 259 7.5e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137250
AA Change: R19S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115
AA Change: R19S

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
SEC14 165 320 7.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176070
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Acvr2a A T 2: 48,870,312 T27S possibly damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cep55 T A 19: 38,069,110 Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Enam A G 5: 88,502,744 D704G probably damaging Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Tnn G C 1: 160,097,228 Y1185* probably null Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Vmn2r93 C T 17: 18,305,166 S362L probably damaging Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Bnipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Bnipl APN 3 95242734 missense probably damaging 1.00
IGL02089:Bnipl APN 3 95250266 splice site probably benign
IGL02273:Bnipl APN 3 95245775 missense possibly damaging 0.58
IGL03250:Bnipl APN 3 95244139 splice site probably benign
R0524:Bnipl UTSW 3 95249829 missense probably benign 0.27
R1181:Bnipl UTSW 3 95245649 critical splice donor site probably null
R1926:Bnipl UTSW 3 95243043 missense probably damaging 1.00
R2072:Bnipl UTSW 3 95244211 missense probably damaging 1.00
R2126:Bnipl UTSW 3 95245683 missense probably damaging 1.00
R2898:Bnipl UTSW 3 95243049 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGCTGTGCATTTTGAGAAAGGG -3'
(R):5'- TTCCTAGGTGAGGCTGAGAG -3'

Sequencing Primer
(F):5'- TGCATTTTGAGAAAGGGATGTAACC -3'
(R):5'- GACACCTTCTTCTGAGCTCCAAGAG -3'
Posted On2014-10-02