Incidental Mutation 'R2196:Urb1'
ID238383
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 040198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2196 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90774256 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1222 (Y1222H)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140158
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: Y1222H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: Y1222H

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Acvr2a A T 2: 48,870,312 T27S possibly damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Bnipl T A 3: 95,249,870 R47S possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cep55 T A 19: 38,069,110 Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Enam A G 5: 88,502,744 D704G probably damaging Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Tnn G C 1: 160,097,228 Y1185* probably null Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Vmn2r93 C T 17: 18,305,166 S362L probably damaging Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGGCCGCATGAAGCTTC -3'
(R):5'- TTGGAAAGACCCTGGTACAAC -3'

Sequencing Primer
(F):5'- GCATGAAGCTTCCTTGCG -3'
(R):5'- AAGACCCTGGTACAACTGCTGG -3'
Posted On2014-10-02