Incidental Mutation 'R2196:Vmn2r93'
ID238384
Institutional Source Beutler Lab
Gene Symbol Vmn2r93
Ensembl Gene ENSMUSG00000079698
Gene Namevomeronasal 2, receptor 93
SynonymsEG627132
MMRRC Submission 040198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2196 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18298099-18331914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18305166 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 362 (S362L)
Ref Sequence ENSEMBL: ENSMUSP00000156230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079206] [ENSMUST00000231879] [ENSMUST00000231938]
Predicted Effect probably damaging
Transcript: ENSMUST00000079206
AA Change: S362L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078200
Gene: ENSMUSG00000079698
AA Change: S362L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 453 5.9e-40 PFAM
Pfam:NCD3G 509 562 2.6e-21 PFAM
Pfam:7tm_3 594 830 1.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231879
AA Change: S362L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231938
AA Change: S362L

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Acvr2a A T 2: 48,870,312 T27S possibly damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Bnipl T A 3: 95,249,870 R47S possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cep55 T A 19: 38,069,110 Y187N probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Enam A G 5: 88,502,744 D704G probably damaging Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Tnn G C 1: 160,097,228 Y1185* probably null Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Vmn2r93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Vmn2r93 APN 17 18326242 missense probably damaging 1.00
IGL01326:Vmn2r93 APN 17 18316644 missense possibly damaging 0.92
IGL01328:Vmn2r93 APN 17 18325557 missense probably benign 0.00
IGL01360:Vmn2r93 APN 17 18305248 missense possibly damaging 0.71
IGL01382:Vmn2r93 APN 17 18313316 nonsense probably null
IGL01463:Vmn2r93 APN 17 18304888 missense probably damaging 1.00
IGL02057:Vmn2r93 APN 17 18325770 missense probably damaging 1.00
IGL02257:Vmn2r93 APN 17 18325508 unclassified probably benign
IGL02686:Vmn2r93 APN 17 18313264 missense possibly damaging 0.89
IGL02720:Vmn2r93 APN 17 18305034 missense probably damaging 1.00
IGL03328:Vmn2r93 APN 17 18304958 missense probably damaging 1.00
PIT4576001:Vmn2r93 UTSW 17 18313211 missense probably benign
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0488:Vmn2r93 UTSW 17 18326049 missense probably damaging 1.00
R0667:Vmn2r93 UTSW 17 18326241 missense probably damaging 1.00
R0668:Vmn2r93 UTSW 17 18298405 missense probably benign 0.00
R0850:Vmn2r93 UTSW 17 18305017 missense possibly damaging 0.93
R0924:Vmn2r93 UTSW 17 18304181 missense probably benign
R0947:Vmn2r93 UTSW 17 18304081 missense probably benign 0.06
R1124:Vmn2r93 UTSW 17 18298448 missense probably benign 0.00
R1584:Vmn2r93 UTSW 17 18305151 missense possibly damaging 0.84
R1943:Vmn2r93 UTSW 17 18325801 missense probably benign 0.04
R2012:Vmn2r93 UTSW 17 18316578 missense probably benign 0.01
R2018:Vmn2r93 UTSW 17 18326062 missense probably damaging 1.00
R2373:Vmn2r93 UTSW 17 18298403 missense probably benign
R2864:Vmn2r93 UTSW 17 18326061 missense probably damaging 1.00
R4276:Vmn2r93 UTSW 17 18304830 missense possibly damaging 0.47
R4446:Vmn2r93 UTSW 17 18304050 missense possibly damaging 0.93
R4537:Vmn2r93 UTSW 17 18304932 missense possibly damaging 0.86
R4674:Vmn2r93 UTSW 17 18304993 missense probably benign 0.34
R4726:Vmn2r93 UTSW 17 18316698 missense probably damaging 1.00
R4936:Vmn2r93 UTSW 17 18304065 missense possibly damaging 0.95
R4984:Vmn2r93 UTSW 17 18313127 splice site probably null
R5111:Vmn2r93 UTSW 17 18326064 missense probably damaging 0.99
R5749:Vmn2r93 UTSW 17 18298284 missense probably benign 0.06
R5918:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R5921:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R6091:Vmn2r93 UTSW 17 18325696 missense probably benign 0.06
R6283:Vmn2r93 UTSW 17 18304104 missense probably benign 0.02
R6680:Vmn2r93 UTSW 17 18316658 nonsense probably null
R6876:Vmn2r93 UTSW 17 18305188 missense probably benign 0.00
R6963:Vmn2r93 UTSW 17 18316587 missense probably damaging 1.00
R6996:Vmn2r93 UTSW 17 18304641 missense probably damaging 1.00
R7027:Vmn2r93 UTSW 17 18313286 missense probably benign 0.01
R7034:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7036:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7246:Vmn2r93 UTSW 17 18325750 missense possibly damaging 0.89
R7258:Vmn2r93 UTSW 17 18305141 missense probably benign 0.32
R7323:Vmn2r93 UTSW 17 18313235 nonsense probably null
R7325:Vmn2r93 UTSW 17 18303987 missense probably benign 0.01
R7390:Vmn2r93 UTSW 17 18305067 missense probably damaging 1.00
R7427:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7428:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7448:Vmn2r93 UTSW 17 18325986 missense probably benign 0.19
R7453:Vmn2r93 UTSW 17 18313318 missense probably benign 0.10
R7562:Vmn2r93 UTSW 17 18298469 missense probably benign 0.01
Z1088:Vmn2r93 UTSW 17 18326403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATGAACACTGAACACCATG -3'
(R):5'- TGTACCTGCCATGGAAAGAAC -3'

Sequencing Primer
(F):5'- AAGCACCATTACAGGGAG -3'
(R):5'- CAAATGGTTGTACTTGAAGTTGC -3'
Posted On2014-10-02