Mutagenetix > Incidental Mutation

Incidental Mutation 'R2196:Ankhd1'

238388

Institutional Source

Beutler Lab

Gene Symbol

Ankhd1

Ensembl Gene

ENSMUSG00000024483

Gene Name

ankyrin repeat and KH domain containing 1

Synonyms

A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik

MMRRC Submission

040198-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36693656-36791961 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36781432 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2161 (N2161K)

Ref Sequence

ENSEMBL: ENSMUSP00000123270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]

AlphaFold

E9PUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000006205
AA Change: N2161K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: N2161K

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000037072
AA Change: N650K

SMART Domains

Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: N650K

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	28	47	N/A	INTRINSIC
low complexity region	75	94	N/A	INTRINSIC
KH	183	253	5.04e-13	SMART
low complexity region	458	491	N/A	INTRINSIC
low complexity region	531	547	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
low complexity region	824	836	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140061
AA Change: N173K

SMART Domains

Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: N173K

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	77	94	N/A	INTRINSIC
low complexity region	355	375	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000142977
AA Change: N2161K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: N2161K

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152940

Predicted Effect

probably damaging
Transcript: ENSMUST00000155329
AA Change: N2161K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: N2161K

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2342	2362	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn2	T	A	13: 12,290,065 (GRCm39)	T734S	probably damaging	Het
Acvr2a	A	T	2: 48,760,324 (GRCm39)	T27S	possibly damaging	Het
Apba3	A	G	10: 81,107,542 (GRCm39)	Y350C	probably damaging	Het
Bnipl	T	A	3: 95,157,181 (GRCm39)	R47S	possibly damaging	Het
Cacna1b	C	T	2: 24,651,800 (GRCm39)	M126I	probably damaging	Het
Cep112	G	A	11: 108,461,187 (GRCm39)	E329K	probably damaging	Het
Cep55	T	A	19: 38,057,558 (GRCm39)	Y187N	probably damaging	Het
Cngb3	T	C	4: 19,415,690 (GRCm39)	I400T	possibly damaging	Het
Csad	T	C	15: 102,096,028 (GRCm39)	N142D	probably benign	Het
Dars1	A	T	1: 128,306,595 (GRCm39)	I195N	probably damaging	Het
Dmxl1	T	A	18: 50,050,698 (GRCm39)	L2454Q	probably benign	Het
Emc1	A	T	4: 139,093,841 (GRCm39)	E650D	probably benign	Het
Enam	A	G	5: 88,650,603 (GRCm39)	D704G	probably damaging	Het
Fat1	T	A	8: 45,477,683 (GRCm39)	I2220N	probably damaging	Het
Fat4	T	C	3: 39,035,566 (GRCm39)	S3073P	probably benign	Het
Fbxl4	T	C	4: 22,403,624 (GRCm39)	M399T	probably benign	Het
Gcsh	G	A	8: 117,715,909 (GRCm39)	T58M	possibly damaging	Het
Ghrhr	T	C	6: 55,356,726 (GRCm39)	Y108H	probably damaging	Het
Gm5431	A	T	11: 48,780,058 (GRCm39)	I566N	probably damaging	Het
Gnb5	A	T	9: 75,234,511 (GRCm39)	D70V	probably damaging	Het
Grin2c	G	T	11: 115,141,492 (GRCm39)	S875R	probably benign	Het
Itch	A	C	2: 155,044,141 (GRCm39)	Q482P	probably benign	Het
Krt87	T	C	15: 101,336,314 (GRCm39)	E113G	probably damaging	Het
Map4	A	G	9: 109,900,116 (GRCm39)	E934G	probably damaging	Het
Mkx	A	G	18: 7,000,675 (GRCm39)	L89P	probably damaging	Het
Myo15a	T	A	11: 60,400,847 (GRCm39)	Y2982*	probably null	Het
Nedd4	C	T	9: 72,632,356 (GRCm39)	L397F	possibly damaging	Het
Nom1	A	G	5: 29,641,019 (GRCm39)	D353G	probably benign	Het
Notch1	A	T	2: 26,353,816 (GRCm39)	L1937*	probably null	Het
Nrxn2	A	T	19: 6,540,139 (GRCm39)	D820V	probably damaging	Het
Nup210	A	T	6: 91,032,226 (GRCm39)	N47K	probably benign	Het
Or1j12	T	A	2: 36,342,600 (GRCm39)	M1K	probably null	Het
Or4p21	G	A	2: 88,277,054 (GRCm39)	T76I	probably benign	Het
Or6d14	A	T	6: 116,533,578 (GRCm39)	Q64L	probably damaging	Het
Pcolce2	A	T	9: 95,576,742 (GRCm39)	I338F	probably damaging	Het
Pkd1	T	C	17: 24,799,046 (GRCm39)	M2755T	possibly damaging	Het
Plekhg4	TAGTCGATGCCCGAGTC	TAGTC	8: 106,103,084 (GRCm39)		probably benign	Het
Rab3a	T	C	8: 71,209,872 (GRCm39)	S51P	probably benign	Het
Scn10a	G	A	9: 119,438,070 (GRCm39)	A1933V	probably benign	Het
Serpina1c	T	A	12: 103,862,370 (GRCm39)	Y315F	probably damaging	Het
Slc29a4	A	C	5: 142,698,650 (GRCm39)	I104L	possibly damaging	Het
Spag16	G	A	1: 69,897,681 (GRCm39)	V144I	possibly damaging	Het
Spata22	A	G	11: 73,236,660 (GRCm39)	K322R	probably benign	Het
Sult2a8	T	A	7: 14,161,778 (GRCm39)	I23L	probably benign	Het
Thoc1	T	A	18: 9,986,300 (GRCm39)	V344D	probably damaging	Het
Tnn	G	C	1: 159,924,798 (GRCm39)	Y1185*	probably null	Het
Trpc4	A	G	3: 54,209,614 (GRCm39)	I660V	probably benign	Het
Urb1	A	G	16: 90,571,144 (GRCm39)	Y1222H	probably benign	Het
Usp4	A	G	9: 108,250,885 (GRCm39)	E531G	probably benign	Het
Vmn2r93	C	T	17: 18,525,428 (GRCm39)	S362L	probably damaging	Het
Zfhx3	G	T	8: 109,526,885 (GRCm39)	E927D	probably damaging	Het
Zfp644	A	T	5: 106,786,469 (GRCm39)	M1K	probably null	Het
Zp2	T	C	7: 119,737,529 (GRCm39)	H252R	probably benign	Het

Other mutations in Ankhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ankhd1	APN	18	36,798,512 (GRCm39)	unclassified	probably benign
IGL00927:Ankhd1	APN	18	36,765,125 (GRCm39)	missense	probably benign	0.01
IGL01367:Ankhd1	APN	18	36,711,696 (GRCm39)	missense	probably benign	0.16
IGL01624:Ankhd1	APN	18	36,791,066 (GRCm39)	missense	probably damaging	1.00
IGL01725:Ankhd1	APN	18	36,781,206 (GRCm39)	missense	probably benign	0.04
IGL01767:Ankhd1	APN	18	36,781,427 (GRCm39)	missense	probably damaging	1.00
IGL02005:Ankhd1	APN	18	36,781,479 (GRCm39)	missense	probably damaging	1.00
IGL02009:Ankhd1	APN	18	36,757,714 (GRCm39)	missense	probably damaging	1.00
IGL02246:Ankhd1	APN	18	36,789,779 (GRCm39)	missense	probably damaging	1.00
IGL02336:Ankhd1	APN	18	36,727,867 (GRCm39)	missense	probably damaging	0.97
IGL02628:Ankhd1	APN	18	36,780,756 (GRCm39)	missense	probably benign	0.00
IGL02644:Ankhd1	APN	18	36,711,828 (GRCm39)	critical splice donor site	probably null
IGL02735:Ankhd1	APN	18	36,781,599 (GRCm39)	missense	probably benign	0.00
IGL02877:Ankhd1	APN	18	36,727,876 (GRCm39)	missense	probably damaging	1.00
IGL03129:Ankhd1	APN	18	36,791,061 (GRCm39)	nonsense	probably null
IGL03163:Ankhd1	APN	18	36,780,681 (GRCm39)	missense	probably damaging	0.97
IGL03182:Ankhd1	APN	18	36,711,827 (GRCm39)	missense	probably benign	0.06
IGL03184:Ankhd1	APN	18	36,780,830 (GRCm39)	missense	probably damaging	1.00
IGL03398:Ankhd1	APN	18	36,789,890 (GRCm39)	splice site	probably benign
FR4304:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
R0051:Ankhd1	UTSW	18	36,780,241 (GRCm39)	unclassified	probably benign
R0089:Ankhd1	UTSW	18	36,773,409 (GRCm39)	missense	probably damaging	0.99
R0105:Ankhd1	UTSW	18	36,779,819 (GRCm39)	missense	probably damaging	1.00
R0149:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0243:Ankhd1	UTSW	18	36,767,787 (GRCm39)	missense	probably damaging	1.00
R0322:Ankhd1	UTSW	18	36,791,061 (GRCm39)	nonsense	probably null
R0361:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0389:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0418:Ankhd1	UTSW	18	36,767,353 (GRCm39)	missense	probably damaging	1.00
R0443:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0540:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0607:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0738:Ankhd1	UTSW	18	36,778,302 (GRCm39)	splice site	probably benign
R1127:Ankhd1	UTSW	18	36,767,399 (GRCm39)	missense	probably damaging	1.00
R1434:Ankhd1	UTSW	18	36,758,212 (GRCm39)	missense	probably benign	0.09
R1742:Ankhd1	UTSW	18	36,758,318 (GRCm39)	missense	probably damaging	1.00
R1776:Ankhd1	UTSW	18	36,780,361 (GRCm39)	missense	probably benign	0.17
R1856:Ankhd1	UTSW	18	36,777,580 (GRCm39)	missense	probably benign	0.00
R1923:Ankhd1	UTSW	18	36,781,083 (GRCm39)	missense	probably benign	0.08
R2044:Ankhd1	UTSW	18	36,778,166 (GRCm39)	missense	probably benign	0.31
R2112:Ankhd1	UTSW	18	36,774,679 (GRCm39)	missense	probably damaging	1.00
R2115:Ankhd1	UTSW	18	36,767,361 (GRCm39)	missense	probably damaging	1.00
R2136:Ankhd1	UTSW	18	36,780,674 (GRCm39)	missense	probably benign
R2291:Ankhd1	UTSW	18	36,777,386 (GRCm39)	missense	probably benign	0.31
R2305:Ankhd1	UTSW	18	36,775,979 (GRCm39)	missense	possibly damaging	0.59
R2309:Ankhd1	UTSW	18	36,757,818 (GRCm39)	missense	probably damaging	1.00
R2519:Ankhd1	UTSW	18	36,711,596 (GRCm39)	splice site	probably null
R2958:Ankhd1	UTSW	18	36,767,782 (GRCm39)	missense	probably damaging	1.00
R3978:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R3980:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R4159:Ankhd1	UTSW	18	36,722,593 (GRCm39)	missense	possibly damaging	0.91
R4199:Ankhd1	UTSW	18	36,794,101 (GRCm39)	unclassified	probably benign
R4323:Ankhd1	UTSW	18	36,711,686 (GRCm39)	missense	probably damaging	1.00
R4356:Ankhd1	UTSW	18	36,776,096 (GRCm39)	nonsense	probably null
R4496:Ankhd1	UTSW	18	36,693,839 (GRCm39)	missense	probably damaging	0.98
R4551:Ankhd1	UTSW	18	36,788,560 (GRCm39)	splice site	probably null
R4590:Ankhd1	UTSW	18	36,716,697 (GRCm39)	missense	probably damaging	1.00
R4667:Ankhd1	UTSW	18	36,781,074 (GRCm39)	missense	possibly damaging	0.77
R4889:Ankhd1	UTSW	18	36,711,787 (GRCm39)	missense	probably null	0.00
R4923:Ankhd1	UTSW	18	36,722,505 (GRCm39)	missense	probably damaging	1.00
R5091:Ankhd1	UTSW	18	36,758,080 (GRCm39)	missense	possibly damaging	0.68
R5254:Ankhd1	UTSW	18	36,789,768 (GRCm39)	missense	probably benign	0.05
R5314:Ankhd1	UTSW	18	36,694,111 (GRCm39)	splice site	probably null
R5336:Ankhd1	UTSW	18	36,779,769 (GRCm39)	missense	probably damaging	1.00
R5367:Ankhd1	UTSW	18	36,722,461 (GRCm39)	missense	probably damaging	1.00
R5384:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5385:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5387:Ankhd1	UTSW	18	36,767,697 (GRCm39)	missense	probably damaging	1.00
R5458:Ankhd1	UTSW	18	36,781,538 (GRCm39)	missense	probably benign	0.01
R5599:Ankhd1	UTSW	18	36,693,860 (GRCm39)	missense	probably damaging	0.98
R5659:Ankhd1	UTSW	18	36,694,103 (GRCm39)	missense	probably damaging	1.00
R5750:Ankhd1	UTSW	18	36,757,955 (GRCm39)	missense	probably benign	0.00
R5874:Ankhd1	UTSW	18	36,773,322 (GRCm39)	missense	possibly damaging	0.92
R5894:Ankhd1	UTSW	18	36,780,577 (GRCm39)	missense	probably damaging	0.99
R5969:Ankhd1	UTSW	18	36,733,887 (GRCm39)	missense	probably damaging	1.00
R6133:Ankhd1	UTSW	18	36,758,179 (GRCm39)	missense	possibly damaging	0.77
R6190:Ankhd1	UTSW	18	36,744,862 (GRCm39)	missense	possibly damaging	0.84
R6247:Ankhd1	UTSW	18	36,787,199 (GRCm39)	missense	probably benign	0.00
R6512:Ankhd1	UTSW	18	36,724,509 (GRCm39)	missense	probably damaging	1.00
R6649:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6653:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6763:Ankhd1	UTSW	18	36,776,022 (GRCm39)	missense	probably benign	0.31
R6976:Ankhd1	UTSW	18	36,781,307 (GRCm39)	missense	probably benign	0.00
R7075:Ankhd1	UTSW	18	36,693,042 (GRCm39)	missense
R7208:Ankhd1	UTSW	18	36,758,081 (GRCm39)	missense	probably benign
R7305:Ankhd1	UTSW	18	36,765,258 (GRCm39)	missense
R7615:Ankhd1	UTSW	18	36,789,826 (GRCm39)	missense
R7654:Ankhd1	UTSW	18	36,727,154 (GRCm39)	missense	probably damaging	1.00
R7781:Ankhd1	UTSW	18	36,758,258 (GRCm39)	missense	probably damaging	1.00
R7842:Ankhd1	UTSW	18	36,780,881 (GRCm39)	missense	probably benign	0.00
R7965:Ankhd1	UTSW	18	36,791,465 (GRCm39)	missense
R8006:Ankhd1	UTSW	18	36,781,772 (GRCm39)	missense
R8037:Ankhd1	UTSW	18	36,771,676 (GRCm39)	missense	probably damaging	0.98
R8123:Ankhd1	UTSW	18	36,708,136 (GRCm39)	missense
R8195:Ankhd1	UTSW	18	36,787,230 (GRCm39)	missense
R8305:Ankhd1	UTSW	18	36,780,219 (GRCm39)	missense	possibly damaging	0.79
R8708:Ankhd1	UTSW	18	36,727,344 (GRCm39)	missense	probably damaging	1.00
R8827:Ankhd1	UTSW	18	36,757,633 (GRCm39)	nonsense	probably null
R9138:Ankhd1	UTSW	18	36,693,961 (GRCm39)	small deletion	probably benign
R9139:Ankhd1	UTSW	18	36,711,810 (GRCm39)	missense
R9186:Ankhd1	UTSW	18	36,767,383 (GRCm39)	missense	possibly damaging	0.95
R9245:Ankhd1	UTSW	18	36,788,653 (GRCm39)	missense
R9254:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9262:Ankhd1	UTSW	18	36,765,799 (GRCm39)	missense
R9379:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9436:Ankhd1	UTSW	18	36,774,654 (GRCm39)	missense	probably benign	0.04
R9436:Ankhd1	UTSW	18	36,694,041 (GRCm39)	missense	probably benign	0.39
R9541:Ankhd1	UTSW	18	36,757,697 (GRCm39)	missense
R9584:Ankhd1	UTSW	18	36,798,504 (GRCm39)	missense	probably benign	0.06
R9664:Ankhd1	UTSW	18	36,780,878 (GRCm39)	missense	probably benign	0.03
RF001:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF004:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF007:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF008:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
RF009:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF013:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF017:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF018:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF026:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,966 (GRCm39)	small insertion	probably benign
RF039:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
RF043:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF046:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF049:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF050:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF054:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF057:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF060:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF061:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF062:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
X0027:Ankhd1	UTSW	18	36,757,885 (GRCm39)	missense	probably damaging	1.00
X0065:Ankhd1	UTSW	18	36,711,817 (GRCm39)	nonsense	probably null
X0066:Ankhd1	UTSW	18	36,779,757 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCATCACCCAGATTGGTTG -3'
(R):5'- ATCTGCAGCAACTCTTGAGG -3'

Sequencing Primer
(F):5'- TGCTGCTGATAATCGGGACAC -3'
(R):5'- CAACTCTTGAGGGCAGAGGTC -3'

Posted On

2014-10-02